Incidental Mutation 'R5138:Olfr419'
ID396255
Institutional Source Beutler Lab
Gene Symbol Olfr419
Ensembl Gene ENSMUSG00000050788
Gene Nameolfactory receptor 419
SynonymsMOR267-6, GA_x6K02T2P20D-20891507-20892448
MMRRC Submission 042724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5138 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174248514-174252061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174250829 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 33 (S33P)
Ref Sequence ENSEMBL: ENSMUSP00000149512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]
Predicted Effect probably benign
Transcript: ENSMUST00000027817
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000061990
AA Change: S33P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788
AA Change: S33P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-53 PFAM
Pfam:7tm_1 41 290 3.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Predicted Effect probably damaging
Transcript: ENSMUST00000214725
AA Change: S33P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.3489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cacna1d C A 14: 30,490,972 A44S probably benign Het
Cbx3 A G 6: 51,475,289 E28G probably damaging Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Kmt2e A G 5: 23,502,695 H1752R probably damaging Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rax A G 18: 65,938,318 probably benign Het
Rgs22 A T 15: 36,099,788 S260R probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tfrc C A 16: 32,615,209 Y85* probably null Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Olfr419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Olfr419 APN 1 174250526 missense probably benign 0.41
IGL01765:Olfr419 APN 1 174250137 missense probably damaging 1.00
IGL02718:Olfr419 APN 1 174250707 nonsense probably null
IGL03208:Olfr419 APN 1 174250393 missense probably damaging 1.00
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1760:Olfr419 UTSW 1 174250360 missense probably damaging 0.99
R2138:Olfr419 UTSW 1 174250736 unclassified probably null
R2139:Olfr419 UTSW 1 174250736 unclassified probably null
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2873:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2874:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R3854:Olfr419 UTSW 1 174250150 missense probably damaging 1.00
R4614:Olfr419 UTSW 1 174250622 missense possibly damaging 0.93
R4858:Olfr419 UTSW 1 174250696 missense probably damaging 1.00
R5015:Olfr419 UTSW 1 174250882 missense possibly damaging 0.91
R5296:Olfr419 UTSW 1 174250756 missense possibly damaging 0.75
R5369:Olfr419 UTSW 1 174250441 missense probably damaging 1.00
R6285:Olfr419 UTSW 1 174250829 missense possibly damaging 0.62
R7655:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7656:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7753:Olfr419 UTSW 1 174250670 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAAAGGAGATGGCTTGTCCCC -3'
(R):5'- TGTGTGTTTTCCAAAAGGCAC -3'

Sequencing Primer
(F):5'- CCCATAACCAGGCCAGAGAG -3'
(R):5'- TGTGTTTTCCAAAAGGCACAAAGAG -3'
Posted On2016-06-21