Incidental Mutation 'R5249:B4galnt4'
ID398808
Institutional Source Beutler Lab
Gene Symbol B4galnt4
Ensembl Gene ENSMUSG00000055629
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 4
SynonymsLOC381951
MMRRC Submission 042820-MU
Accession Numbers

Genbank: NM_177897; MGI: 2652891

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141061104-141072400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141065070 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 219 (T219I)
Ref Sequence ENSEMBL: ENSMUSP00000039758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048002]
Predicted Effect probably damaging
Transcript: ENSMUST00000048002
AA Change: T219I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039758
Gene: ENSMUSG00000055629
AA Change: T219I

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
PA14 129 276 6.07e-7 SMART
low complexity region 412 421 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
low complexity region 461 481 N/A INTRINSIC
low complexity region 634 660 N/A INTRINSIC
Pfam:CHGN 691 1024 8.9e-31 PFAM
Pfam:Glyco_transf_7C 939 1017 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210203
Meta Mutation Damage Score 0.1127 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in B4galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:B4galnt4 APN 7 141070515 missense probably benign 0.15
IGL02055:B4galnt4 APN 7 141070818 missense probably damaging 1.00
IGL02248:B4galnt4 APN 7 141067808 unclassified probably benign
IGL02955:B4galnt4 APN 7 141064678 missense probably null 0.08
IGL03334:B4galnt4 APN 7 141067441 splice site probably null
H8786:B4galnt4 UTSW 7 141071322 missense probably damaging 0.99
R0520:B4galnt4 UTSW 7 141067373 nonsense probably null
R0735:B4galnt4 UTSW 7 141064323 missense probably benign 0.24
R1355:B4galnt4 UTSW 7 141065395 missense probably damaging 1.00
R1864:B4galnt4 UTSW 7 141070533 missense probably damaging 1.00
R1874:B4galnt4 UTSW 7 141070526 missense probably damaging 1.00
R1928:B4galnt4 UTSW 7 141068148 nonsense probably null
R1969:B4galnt4 UTSW 7 141064848 missense probably benign 0.01
R3429:B4galnt4 UTSW 7 141070839 missense probably damaging 1.00
R4239:B4galnt4 UTSW 7 141061326 missense probably damaging 1.00
R4382:B4galnt4 UTSW 7 141070536 missense probably damaging 0.99
R4517:B4galnt4 UTSW 7 141067722 missense probably damaging 1.00
R4748:B4galnt4 UTSW 7 141071720 missense probably damaging 1.00
R4827:B4galnt4 UTSW 7 141068479 missense probably benign 0.00
R4831:B4galnt4 UTSW 7 141067721 missense probably damaging 0.99
R4831:B4galnt4 UTSW 7 141064557 critical splice donor site probably null
R4898:B4galnt4 UTSW 7 141068260 missense probably benign 0.11
R5028:B4galnt4 UTSW 7 141068062 missense probably benign 0.40
R5267:B4galnt4 UTSW 7 141070611 missense probably damaging 0.99
R5728:B4galnt4 UTSW 7 141070575 missense probably benign 0.00
R5924:B4galnt4 UTSW 7 141070829 missense probably damaging 1.00
R6063:B4galnt4 UTSW 7 141064730 missense probably benign 0.08
R6311:B4galnt4 UTSW 7 141068659 missense probably damaging 1.00
R6376:B4galnt4 UTSW 7 141067422 missense possibly damaging 0.87
R6689:B4galnt4 UTSW 7 141067984 missense probably benign 0.25
R6954:B4galnt4 UTSW 7 141067232 missense probably benign 0.01
R6974:B4galnt4 UTSW 7 141067536 missense possibly damaging 0.95
R7041:B4galnt4 UTSW 7 141070680 missense probably damaging 1.00
R7092:B4galnt4 UTSW 7 141068636 missense probably damaging 1.00
R7359:B4galnt4 UTSW 7 141071284 missense probably damaging 1.00
R7367:B4galnt4 UTSW 7 141064475 missense probably damaging 1.00
R7409:B4galnt4 UTSW 7 141067003 splice site probably null
R7519:B4galnt4 UTSW 7 141064344 missense probably damaging 1.00
R7664:B4galnt4 UTSW 7 141067713 missense probably damaging 1.00
R7679:B4galnt4 UTSW 7 141067765 missense probably benign 0.28
R7782:B4galnt4 UTSW 7 141065075 missense probably damaging 1.00
R8103:B4galnt4 UTSW 7 141064651 missense possibly damaging 0.91
R8783:B4galnt4 UTSW 7 141063846 missense probably damaging 1.00
R8796:B4galnt4 UTSW 7 141067575 missense probably damaging 1.00
R8855:B4galnt4 UTSW 7 141068575 missense possibly damaging 0.68
RF007:B4galnt4 UTSW 7 141070696 critical splice donor site probably null
YA93:B4galnt4 UTSW 7 141067411 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCAAGGTAAGTTCTGCCCTC -3'
(R):5'- TGGGGTTGCTTCTCATCAAACAG -3'

Sequencing Primer
(F):5'- AAGGTAAGTTCTGCCCTCTTGCC -3'
(R):5'- GGGTTAGGACAAAATCTCATATCCC -3'
Posted On2016-07-06