Incidental Mutation 'R4517:B4galnt4'
ID332953
Institutional Source Beutler Lab
Gene Symbol B4galnt4
Ensembl Gene ENSMUSG00000055629
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 4
SynonymsLOC381951
MMRRC Submission 041761-MU
Accession Numbers

Genbank: NM_177897; MGI: 2652891

Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4517 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141061104-141072400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141067722 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 408 (K408E)
Ref Sequence ENSEMBL: ENSMUSP00000039758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048002]
Predicted Effect probably damaging
Transcript: ENSMUST00000048002
AA Change: K408E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039758
Gene: ENSMUSG00000055629
AA Change: K408E

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
PA14 129 276 6.07e-7 SMART
low complexity region 412 421 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
low complexity region 461 481 N/A INTRINSIC
low complexity region 634 660 N/A INTRINSIC
Pfam:CHGN 691 1024 8.9e-31 PFAM
Pfam:Glyco_transf_7C 939 1017 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210203
Predicted Effect probably benign
Transcript: ENSMUST00000210517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211455
Meta Mutation Damage Score 0.0973 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (39/41)
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank A G 15: 27,562,749 H181R possibly damaging Het
Cd209a T A 8: 3,745,525 D123V probably damaging Het
Cyp4f37 A G 17: 32,631,592 I340V probably benign Het
Echs1 A G 7: 140,112,496 S113P possibly damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fap T C 2: 62,530,715 I391V probably benign Het
Glb1l C T 1: 75,208,703 C121Y probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Ibsp C A 5: 104,305,997 S67* probably null Het
Ifit1bl2 C T 19: 34,629,764 probably benign Het
Iqgap2 A G 13: 95,664,061 probably null Het
Kcnma1 A G 14: 23,337,029 S982P probably damaging Het
Kif5b T C 18: 6,213,272 S707G probably benign Het
Lrrk2 A G 15: 91,705,120 I437V probably benign Het
Mapkbp1 T C 2: 120,025,064 probably benign Het
Mcu T C 10: 59,467,634 Y127C probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Nr2f2 T G 7: 70,358,122 N204T probably benign Het
Olfr541 A G 7: 140,705,091 Y280C probably damaging Het
Olfr8 T A 10: 78,956,043 Y279* probably null Het
Pcf11 T C 7: 92,646,488 Y1451C probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Rttn T C 18: 89,028,973 S920P probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tas2r135 A T 6: 42,406,079 H184L probably benign Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r102 A G 17: 19,681,213 Y534C probably damaging Het
Wdr62 A G 7: 30,270,258 V259A probably damaging Het
Whrn A G 4: 63,461,280 probably null Het
Other mutations in B4galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:B4galnt4 APN 7 141070515 missense probably benign 0.15
IGL02055:B4galnt4 APN 7 141070818 missense probably damaging 1.00
IGL02248:B4galnt4 APN 7 141067808 unclassified probably benign
IGL02955:B4galnt4 APN 7 141064678 missense probably null 0.08
IGL03334:B4galnt4 APN 7 141067441 splice site probably null
H8786:B4galnt4 UTSW 7 141071322 missense probably damaging 0.99
R0520:B4galnt4 UTSW 7 141067373 nonsense probably null
R0735:B4galnt4 UTSW 7 141064323 missense probably benign 0.24
R1355:B4galnt4 UTSW 7 141065395 missense probably damaging 1.00
R1864:B4galnt4 UTSW 7 141070533 missense probably damaging 1.00
R1874:B4galnt4 UTSW 7 141070526 missense probably damaging 1.00
R1928:B4galnt4 UTSW 7 141068148 nonsense probably null
R1969:B4galnt4 UTSW 7 141064848 missense probably benign 0.01
R3429:B4galnt4 UTSW 7 141070839 missense probably damaging 1.00
R4239:B4galnt4 UTSW 7 141061326 missense probably damaging 1.00
R4382:B4galnt4 UTSW 7 141070536 missense probably damaging 0.99
R4748:B4galnt4 UTSW 7 141071720 missense probably damaging 1.00
R4827:B4galnt4 UTSW 7 141068479 missense probably benign 0.00
R4831:B4galnt4 UTSW 7 141067721 missense probably damaging 0.99
R4831:B4galnt4 UTSW 7 141064557 critical splice donor site probably null
R4898:B4galnt4 UTSW 7 141068260 missense probably benign 0.11
R5028:B4galnt4 UTSW 7 141068062 missense probably benign 0.40
R5249:B4galnt4 UTSW 7 141065070 missense probably damaging 1.00
R5267:B4galnt4 UTSW 7 141070611 missense probably damaging 0.99
R5728:B4galnt4 UTSW 7 141070575 missense probably benign 0.00
R5924:B4galnt4 UTSW 7 141070829 missense probably damaging 1.00
R6063:B4galnt4 UTSW 7 141064730 missense probably benign 0.08
R6311:B4galnt4 UTSW 7 141068659 missense probably damaging 1.00
R6376:B4galnt4 UTSW 7 141067422 missense possibly damaging 0.87
R6689:B4galnt4 UTSW 7 141067984 missense probably benign 0.25
R6954:B4galnt4 UTSW 7 141067232 missense probably benign 0.01
R6974:B4galnt4 UTSW 7 141067536 missense possibly damaging 0.95
R7041:B4galnt4 UTSW 7 141070680 missense probably damaging 1.00
R7092:B4galnt4 UTSW 7 141068636 missense probably damaging 1.00
R7359:B4galnt4 UTSW 7 141071284 missense probably damaging 1.00
R7367:B4galnt4 UTSW 7 141064475 missense probably damaging 1.00
R7409:B4galnt4 UTSW 7 141067003 splice site probably null
R7519:B4galnt4 UTSW 7 141064344 missense probably damaging 1.00
R7664:B4galnt4 UTSW 7 141067713 missense probably damaging 1.00
R7679:B4galnt4 UTSW 7 141067765 missense probably benign 0.28
R7782:B4galnt4 UTSW 7 141065075 missense probably damaging 1.00
RF007:B4galnt4 UTSW 7 141070696 critical splice donor site probably null
YA93:B4galnt4 UTSW 7 141067411 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAAGCTACCCTTTGCCCCAG -3'
(R):5'- GTCTAACAGATCCTGCTCATCC -3'

Sequencing Primer
(F):5'- TACCCCTGAGCCATCGG -3'
(R):5'- AACAGATCCTGCTCATCCTCCTC -3'
Posted On2015-08-18