Incidental Mutation 'R5274:Ighmbp2'
ID403856
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
MMRRC Submission 042837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5274 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3265518 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 634 (E634G)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025751
AA Change: E634G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: E634G

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119292
AA Change: E634G

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: E634G

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143079
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 98.0%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Ace T C 11: 105,968,037 M19T probably benign Het
Agl A G 3: 116,772,486 L995P probably damaging Het
AY761185 T C 8: 20,943,873 N90S unknown Het
Brca2 T C 5: 150,539,689 S973P probably benign Het
Cacna1e T C 1: 154,700,504 T66A probably damaging Het
Cbarp T C 10: 80,131,815 S531G possibly damaging Het
Cd96 G T 16: 46,069,703 T319K possibly damaging Het
Chil5 A C 3: 106,028,853 F41C probably damaging Het
Col24a1 A C 3: 145,484,678 E1239D probably benign Het
Dip2b A G 15: 100,212,104 E1490G possibly damaging Het
Dync1li1 T C 9: 114,715,205 V315A possibly damaging Het
Dync2h1 T C 9: 7,116,540 S99G probably benign Het
E2f8 C T 7: 48,867,177 R818H probably damaging Het
Eomes T C 9: 118,480,529 V250A probably damaging Het
Esyt3 T C 9: 99,318,297 T615A probably benign Het
Fbxo38 A T 18: 62,515,069 D799E probably damaging Het
Fdft1 A G 14: 63,152,343 F288S probably damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm4871 C G 5: 145,030,370 E185Q probably damaging Het
Gm5155 T C 7: 17,915,717 probably null Het
Gm5901 C A 7: 105,377,448 P141Q probably damaging Het
Herc1 T A 9: 66,399,409 I933N probably benign Het
Ifih1 T C 2: 62,611,718 Q385R probably benign Het
Klk6 C G 7: 43,829,129 probably null Het
Kmt2d A G 15: 98,854,230 probably benign Het
Lig3 T A 11: 82,797,292 probably null Het
Lrp1b T C 2: 41,344,444 D310G probably null Het
Mroh6 A G 15: 75,885,000 V571A possibly damaging Het
Olfm5 A G 7: 104,159,983 S132P probably damaging Het
Olfr488 A T 7: 108,255,635 F168I probably benign Het
Olfr659 T C 7: 104,671,526 S275P probably damaging Het
Patj G C 4: 98,518,981 S4T probably damaging Het
Pcdhga12 T A 18: 37,766,422 C102* probably null Het
Pik3ap1 T C 19: 41,281,952 D766G possibly damaging Het
Plch2 A T 4: 154,998,954 L408Q probably damaging Het
Pnma2 G T 14: 66,916,760 R211L probably damaging Het
Prkg2 T A 5: 98,969,991 H468L probably damaging Het
Rad1 T A 15: 10,487,973 probably null Het
Rims3 A G 4: 120,891,374 D264G probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rrm2 T A 12: 24,710,407 Y75* probably null Het
Sall3 T C 18: 80,969,837 N1128S probably benign Het
Slc26a5 T C 5: 21,813,901 T610A possibly damaging Het
Snx29 G T 16: 11,738,404 E766D probably damaging Het
Sox17 A G 1: 4,491,888 V298A possibly damaging Het
Spert A G 14: 75,583,226 V362A probably benign Het
Ss18 G A 18: 14,641,049 Q228* probably null Het
Tas2r121 A G 6: 132,700,848 S54P probably damaging Het
Tctex1d1 A T 4: 103,002,571 T103S possibly damaging Het
Tmem206 T C 1: 191,348,468 V295A probably damaging Het
Ttc21b T C 2: 66,236,283 E342G possibly damaging Het
Ubap2l A G 3: 90,012,730 Y818H probably damaging Het
Usp15 C A 10: 123,168,351 R166I probably damaging Het
Vmn1r34 T G 6: 66,637,139 H205P probably damaging Het
Vmn2r22 A T 6: 123,650,634 M1K probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zdhhc1 T C 8: 105,483,770 N5S probably benign Het
Zfp758 T A 17: 22,375,855 C441S probably benign Het
Zp2 T C 7: 120,138,092 E291G possibly damaging Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7819:Ighmbp2 UTSW 19 3267276 missense possibly damaging 0.46
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
R7960:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3265635 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3267242 missense probably null 1.00
Z1177:Ighmbp2 UTSW 19 3271665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTTGCACTGGAGCTGTG -3'
(R):5'- GTTCCTGACTGTCCCTGAAC -3'

Sequencing Primer
(F):5'- CTTCCTGCGGCCATGTCTAGG -3'
(R):5'- AGGTGTTCTGTTCCCTGCCTTG -3'
Posted On2016-07-22