Incidental Mutation 'R5302:Mrps26'
ID404285
Institutional Source Beutler Lab
Gene Symbol Mrps26
Ensembl Gene ENSMUSG00000037740
Gene Namemitochondrial ribosomal protein S26
SynonymsRpms13, GI008, MRP-S13, MRP-S26
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R5302 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location130563742-130568695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130564167 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 100 (T100K)
Ref Sequence ENSEMBL: ENSMUSP00000123324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145614]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136793
Predicted Effect probably benign
Transcript: ENSMUST00000145614
AA Change: T100K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123324
Gene: ENSMUSG00000037740
AA Change: T100K

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
Pfam:MRP-S26 28 197 8.1e-59 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. This gene lies adjacent to and downstream of the gonadotropin-releasing hormone precursor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
BC035947 A T 1: 78,511,962 M1K probably null Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in Mrps26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03267:Mrps26 APN 2 130564936 critical splice acceptor site probably null
R0608:Mrps26 UTSW 2 130563858 missense possibly damaging 0.93
R1188:Mrps26 UTSW 2 130564381 missense probably damaging 1.00
R2054:Mrps26 UTSW 2 130564167 missense probably benign 0.05
R2850:Mrps26 UTSW 2 130565047 missense probably benign 0.03
R4519:Mrps26 UTSW 2 130564349 missense probably benign
R4851:Mrps26 UTSW 2 130563761 utr 5 prime probably benign
R4930:Mrps26 UTSW 2 130564942 missense probably damaging 1.00
R5091:Mrps26 UTSW 2 130563966 missense probably damaging 1.00
R8277:Mrps26 UTSW 2 130564427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTCGTGTTGACCGAGCG -3'
(R):5'- TTTCAGTTGCACCCAAGCC -3'

Sequencing Primer
(F):5'- TGTTGACCGAGCGCTACC -3'
(R):5'- AAGCCTGCTCCTCCTGAG -3'
Posted On2016-07-22