Incidental Mutation 'R5302:BC035947'
ID404278
Institutional Source Beutler Lab
Gene Symbol BC035947
Ensembl Gene ENSMUSG00000090486
Gene NamecDNA sequence BC035947
Synonyms
MMRRC Submission 042885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5302 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78497026-78512158 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 78511962 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000132488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111] [ENSMUST00000170511]
Predicted Effect probably benign
Transcript: ENSMUST00000012331
AA Change: M1L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113524
AA Change: M1L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134947
AA Change: M1L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149732
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152111
AA Change: M1L

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187
AA Change: M1L

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170511
AA Change: M1K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486
AA Change: M1K

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,952 V1657A possibly damaging Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Acot5 A G 12: 84,073,441 Y190C probably damaging Het
Ascc3 T A 10: 50,707,777 Y941N probably benign Het
C2cd5 A G 6: 143,073,756 C278R probably benign Het
Cd200r1 G T 16: 44,792,809 L259F possibly damaging Het
Clcn4 A G 7: 7,294,051 V136A possibly damaging Het
Cntnap5a T C 1: 116,157,570 S413P probably benign Het
Corin T A 5: 72,316,098 E748D probably benign Het
Crtc2 G T 3: 90,261,018 G356V probably damaging Het
D1Pas1 T A 1: 186,969,445 Y524N probably damaging Het
Dlgap4 T C 2: 156,760,898 S147P probably damaging Het
Enpp1 A T 10: 24,651,390 I633N probably benign Het
Gm3095 A G 14: 3,964,498 D72G probably null Het
Gm5449 C T 13: 53,525,751 noncoding transcript Het
Gm6803 T A 12: 88,018,546 I76F probably damaging Het
Gpx7 T C 4: 108,400,914 T161A probably benign Het
Grip1 T C 10: 120,020,077 L236P probably damaging Het
H2-Q2 G T 17: 35,344,909 R255S probably damaging Het
Il17rc G T 6: 113,483,036 A648S possibly damaging Het
Klhl12 A G 1: 134,489,451 E540G possibly damaging Het
Mcm10 T C 2: 5,007,370 I135V probably benign Het
Mrps26 C A 2: 130,564,167 T100K probably benign Het
Nid2 A G 14: 19,779,701 T687A probably benign Het
Npas3 A T 12: 54,068,836 D829V probably damaging Het
Ocln T C 13: 100,506,299 D176G probably damaging Het
Olfr745 A G 14: 50,642,319 probably null Het
Pax3 A C 1: 78,121,612 M380R possibly damaging Het
Pcdha3 A G 18: 36,948,155 E650G probably damaging Het
Pdcd11 C A 19: 47,107,644 H668N probably damaging Het
Polr3b T C 10: 84,699,400 Y858H possibly damaging Het
Pus10 T C 11: 23,667,416 probably null Het
Raver1 T C 9: 21,075,381 D739G probably damaging Het
Slc26a11 T C 11: 119,363,450 L198P probably damaging Het
Slc44a3 A G 3: 121,510,313 V258A probably damaging Het
Socs7 T A 11: 97,389,199 I524N probably damaging Het
Steap4 T A 5: 7,975,547 L36* probably null Het
Svep1 G C 4: 58,096,183 T1479S possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Ttn C A 2: 76,717,275 V32184F probably damaging Het
Vmn1r22 T C 6: 57,900,975 N6D possibly damaging Het
Other mutations in BC035947
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1853:BC035947 UTSW 1 78499016 missense possibly damaging 0.95
R2079:BC035947 UTSW 1 78511924 utr 5 prime probably benign
R2234:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R2235:BC035947 UTSW 1 78497962 missense probably damaging 0.98
R3840:BC035947 UTSW 1 78497845 missense probably benign 0.00
R3841:BC035947 UTSW 1 78497845 missense probably benign 0.00
R4804:BC035947 UTSW 1 78497876 missense probably damaging 1.00
R4909:BC035947 UTSW 1 78498029 missense probably damaging 0.99
R5139:BC035947 UTSW 1 78499247 missense possibly damaging 0.60
R5669:BC035947 UTSW 1 78497913 missense probably damaging 0.98
R5686:BC035947 UTSW 1 78497930 missense probably benign 0.03
R5868:BC035947 UTSW 1 78498323 missense probably damaging 1.00
R5988:BC035947 UTSW 1 78499206 nonsense probably null
R6787:BC035947 UTSW 1 78498890 missense possibly damaging 0.64
R6854:BC035947 UTSW 1 78498488 missense probably damaging 1.00
R7079:BC035947 UTSW 1 78497915 missense probably damaging 1.00
R7168:BC035947 UTSW 1 78499593 missense probably benign 0.04
R7387:BC035947 UTSW 1 78498461 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCGGTCTATCAGATGAACAATGG -3'
(R):5'- GTGAACACTGTCTGACCAGG -3'

Sequencing Primer
(F):5'- ACGAGTGACCAGGGTTCTG -3'
(R):5'- TGTCTGACCAGGCAGACC -3'
Posted On2016-07-22