Incidental Mutation 'R0491:Crxos'
ID42468
Institutional Source Beutler Lab
Gene Symbol Crxos
Ensembl Gene ENSMUSG00000074365
Gene Namecone-rod homeobox, opposite strand
SynonymsCrxos1, Egam1
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0491 (G1)
Quality Score100
Status Validated
Chromosome7
Chromosomal Location15882617-15904020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15898535 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 89 (S89T)
Ref Sequence ENSEMBL: ENSMUSP00000096399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098801] [ENSMUST00000125993] [ENSMUST00000130566] [ENSMUST00000150050] [ENSMUST00000171280] [ENSMUST00000173808]
Predicted Effect probably benign
Transcript: ENSMUST00000098801
AA Change: S89T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000096399
Gene: ENSMUSG00000074365
AA Change: S89T

DomainStartEndE-ValueType
HOX 13 75 6.06e-4 SMART
HOX 123 185 3.93e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125993
AA Change: S44T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139388
Gene: ENSMUSG00000074365
AA Change: S44T

DomainStartEndE-ValueType
Blast:HOX 1 30 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130566
AA Change: S44T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138909
Gene: ENSMUSG00000074365
AA Change: S44T

DomainStartEndE-ValueType
Blast:HOX 1 30 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150050
AA Change: S89T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133563
Gene: ENSMUSG00000074365
AA Change: S89T

DomainStartEndE-ValueType
HOX 13 75 6.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171280
SMART Domains Protein: ENSMUSP00000130485
Gene: ENSMUSG00000074365

DomainStartEndE-ValueType
HOX 19 81 3.93e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173808
SMART Domains Protein: ENSMUSP00000138891
Gene: ENSMUSG00000074365

DomainStartEndE-ValueType
Pfam:Homeobox 8 50 2.4e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Crxos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Crxos APN 7 15898618 nonsense probably null
IGL02888:Crxos APN 7 15902930 missense possibly damaging 0.71
R0060:Crxos UTSW 7 15898523 missense possibly damaging 0.94
R5111:Crxos UTSW 7 15896217 unclassified probably benign
R6185:Crxos UTSW 7 15902880 missense possibly damaging 0.71
R7474:Crxos UTSW 7 15902931 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATGCCCCTAGCATGACCTCAAAG -3'
(R):5'- ATCTGTCCTGGCACCCAGGTATTC -3'

Sequencing Primer
(F):5'- CTAGCATGACCTCAAAGGCTAGG -3'
(R):5'- GGCATCCACCATTTGATGAG -3'
Posted On2013-05-23