Incidental Mutation 'R0491:Scarb1'
ID42459
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Namescavenger receptor class B, member 1
SynonymsCd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0491 (G1)
Quality Score208
Status Validated
Chromosome5
Chromosomal Location125277087-125341094 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 125298731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000127148] [ENSMUST00000137783]
Predicted Effect probably benign
Transcript: ENSMUST00000086075
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111390
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123338
Predicted Effect probably benign
Transcript: ENSMUST00000127148
SMART Domains Protein: ENSMUSP00000122100
Gene: ENSMUSG00000037936

DomainStartEndE-ValueType
Pfam:CD36 1 123 1.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133624
Predicted Effect probably benign
Transcript: ENSMUST00000137783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148373
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0655:Scarb1 UTSW 5 125300440 missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6321:Scarb1 UTSW 5 125304331 missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7830:Scarb1 UTSW 5 125287383 missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R7956:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGTTCTGGTGTAGTCCCCACA -3'
(R):5'- GCCCTTCTACTGAGCTTCTAGATCGT -3'

Sequencing Primer
(F):5'- CACCAATCGATGGGGACTG -3'
(R):5'- tgggagtatgaggcaggag -3'
Posted On2013-05-23