Incidental Mutation 'R5392:Vps9d1'
List |< first << previous [record 37 of 41] next >> last >|
ID425911
Institutional Source Beutler Lab
Gene Symbol Vps9d1
Ensembl Gene ENSMUSG00000001062
Gene NameVPS9 domain containing 1
Synonyms
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score136
Status Not validated
Chromosome8
Chromosomal Location123242356-123254348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123254013 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 25 (E25G)
Ref Sequence ENSEMBL: ENSMUSP00000113634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000155869] [ENSMUST00000154450]
Predicted Effect probably benign
Transcript: ENSMUST00000001092
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117643
AA Change: E25G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062
AA Change: E25G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118279
AA Change: E25G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062
AA Change: E25G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122363
AA Change: E25G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062
AA Change: E25G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149490
Predicted Effect possibly damaging
Transcript: ENSMUST00000155869
AA Change: E25G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062
AA Change: E25G

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211828
Predicted Effect probably benign
Transcript: ENSMUST00000154450
SMART Domains Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.9e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
Mta1 T C 12: 113,133,236 V559A probably benign Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Vps9d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Vps9d1 APN 8 123245198 missense probably damaging 1.00
IGL01112:Vps9d1 APN 8 123246030 missense probably damaging 1.00
IGL01729:Vps9d1 APN 8 123247000 missense probably damaging 1.00
R0568:Vps9d1 UTSW 8 123246748 missense probably damaging 1.00
R1191:Vps9d1 UTSW 8 123247967 missense possibly damaging 0.95
R1813:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R1896:Vps9d1 UTSW 8 123247039 missense probably damaging 0.99
R2193:Vps9d1 UTSW 8 123252665 missense probably damaging 1.00
R2256:Vps9d1 UTSW 8 123245121 missense probably benign 0.18
R4305:Vps9d1 UTSW 8 123248237 intron probably benign
R4458:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R4707:Vps9d1 UTSW 8 123248612 critical splice donor site probably benign
R5366:Vps9d1 UTSW 8 123245114 missense possibly damaging 0.89
R5423:Vps9d1 UTSW 8 123247965 critical splice donor site probably null
R5645:Vps9d1 UTSW 8 123247748 missense probably benign 0.30
R5647:Vps9d1 UTSW 8 123248859 missense probably damaging 1.00
R5695:Vps9d1 UTSW 8 123246916 missense probably benign
R5908:Vps9d1 UTSW 8 123246824 missense probably benign 0.28
R6061:Vps9d1 UTSW 8 123245671 missense probably damaging 0.99
R6250:Vps9d1 UTSW 8 123248208 critical splice acceptor site probably null
R6416:Vps9d1 UTSW 8 123248639 missense probably damaging 1.00
R6747:Vps9d1 UTSW 8 123254007 missense probably damaging 1.00
R7049:Vps9d1 UTSW 8 123247143 nonsense probably null
R7584:Vps9d1 UTSW 8 123250717 missense probably damaging 1.00
R8321:Vps9d1 UTSW 8 123248805 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGTAAATCTAGGCCCAGTGC -3'
(R):5'- AGGTGACAAGAGCCACTGAC -3'

Sequencing Primer
(F):5'- CAGTGCGAGCTGAGCTGTTC -3'
(R):5'- TAAACCCAAGTCTGCGCGG -3'
Posted On2016-08-04