Incidental Mutation 'R4778:Csrp3'
ID426215
Institutional Source Beutler Lab
Gene Symbol Csrp3
Ensembl Gene ENSMUSG00000030470
Gene Namecysteine and glycine-rich protein 3
SynonymsMLP, muscle LIM protein, CRP3
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48830398-48848033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 48832563 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 169 (K169N)
Ref Sequence ENSEMBL: ENSMUSP00000129378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032658] [ENSMUST00000167786] [ENSMUST00000208050]
Predicted Effect probably damaging
Transcript: ENSMUST00000032658
AA Change: K169N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032658
Gene: ENSMUSG00000030470
AA Change: K169N

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167786
AA Change: K169N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129378
Gene: ENSMUSG00000030470
AA Change: K169N

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208146
Meta Mutation Damage Score 0.2910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit dilated cardiomyopathy characterized by disrupted cardiomyocyte organization that results in premature death, left ventricle dilation, hypertrophy, decreased contractility, and fibrosis. Some homozygotes die postnataly due to heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Csrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Csrp3 APN 7 48830692 missense probably benign 0.24
R1203:Csrp3 UTSW 7 48839530 start codon destroyed probably null 0.97
R5577:Csrp3 UTSW 7 48839477 missense possibly damaging 0.90
R6010:Csrp3 UTSW 7 48835465 critical splice donor site probably null
R6472:Csrp3 UTSW 7 48835608 missense possibly damaging 0.93
R7214:Csrp3 UTSW 7 48830637 missense probably benign
R7309:Csrp3 UTSW 7 48835569 missense probably benign
R7803:Csrp3 UTSW 7 48833797 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTGCAAATTTCCAGTGGGG -3'
(R):5'- AACCCCTGGGATTATTAGTTGAGG -3'

Sequencing Primer
(F):5'- TCCTGATTTGTGGCAGAC -3'
(R):5'- TTGAGGGCCCCTTAACATAAG -3'
Posted On2016-08-25