Incidental Mutation 'R5433:Il1a'
ID428136
Institutional Source Beutler Lab
Gene Symbol Il1a
Ensembl Gene ENSMUSG00000027399
Gene Nameinterleukin 1 alpha
SynonymsIl-1a
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129299610-129309972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129307901 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 26 (D26E)
Ref Sequence ENSEMBL: ENSMUSP00000028882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028882
AA Change: D26E

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028882
Gene: ENSMUSG00000027399
AA Change: D26E

DomainStartEndE-ValueType
Pfam:IL1_propep 1 111 2.2e-38 PFAM
IL1 131 270 8.14e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144178
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal tumor vascularization, decreased metastatic potential, and decreased interleukin-1 beta secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Il1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Il1a APN 2 129304717 missense probably benign
IGL01726:Il1a APN 2 129304720 missense possibly damaging 0.47
IGL02451:Il1a APN 2 129306655 missense probably damaging 0.98
IGL02537:Il1a APN 2 129309076 missense probably damaging 0.98
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0759:Il1a UTSW 2 129304687 missense probably damaging 1.00
R1388:Il1a UTSW 2 129306581 missense possibly damaging 0.92
R1521:Il1a UTSW 2 129304741 missense possibly damaging 0.83
R1699:Il1a UTSW 2 129302893 missense probably damaging 0.98
R3833:Il1a UTSW 2 129306679 missense possibly damaging 0.81
R4591:Il1a UTSW 2 129306527 missense probably damaging 1.00
R4643:Il1a UTSW 2 129304703 missense probably benign
R5572:Il1a UTSW 2 129307918 missense possibly damaging 0.83
R7345:Il1a UTSW 2 129304773 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAATGAACATGAAGAATGCC -3'
(R):5'- CTCAGTGGTGCCTATGCCTAAATC -3'

Sequencing Primer
(F):5'- ACTAGTATGAAGAACCAAGTGATCTC -3'
(R):5'- GTGCCTATGCCTAAATCAGTTTTTAG -3'
Posted On2016-09-01