Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Tctn1'

428416

Institutional Source

Beutler Lab

Gene Symbol

Tctn1

Ensembl Gene

ENSMUSG00000038593

Gene Name

tectonic family member 1

Synonyms

G730031O11Rik, Tect1

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122237848-122264460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122258879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 147 (I147T)

Ref Sequence

ENSEMBL: ENSMUSP00000114820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111738] [ENSMUST00000141281]

AlphaFold

Q8BZ64

Predicted Effect

probably benign
Transcript: ENSMUST00000111738
AA Change: I147T

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107367
Gene: ENSMUSG00000038593
AA Change: I147T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	24	36	N/A	INTRINSIC
Pfam:DUF1619	82	395	8.4e-84	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137118

Predicted Effect

probably benign
Transcript: ENSMUST00000141281
AA Change: I147T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000114820
Gene: ENSMUSG00000038593
AA Change: I147T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	24	36	N/A	INTRINSIC
Pfam:DUF1619	82	384	1.5e-84	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177148

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of secreted and transmembrane proteins. The orthologous gene in mouse functions downstream of smoothened and rab23 to modulate hedgehog signal transduction. This protein is a component of the tectonic-like complex, which forms a barrier between the ciliary axoneme and the basal body. A mutation in this gene was found in a family with Joubert syndrome-13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality, holoprosencephaly and lack a neural floor plate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Tctn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01115:Tctn1	APN	5	122264207	missense	probably benign	0.03
IGL02019:Tctn1	APN	5	122258849	missense	probably damaging	1.00
IGL02810:Tctn1	APN	5	122242601	splice site	probably null
R0648:Tctn1	UTSW	5	122251698	missense	probably benign	0.00
R0883:Tctn1	UTSW	5	122264144	missense	probably damaging	1.00
R0969:Tctn1	UTSW	5	122241777	missense	probably benign	0.27
R1172:Tctn1	UTSW	5	122251689	nonsense	probably null
R1959:Tctn1	UTSW	5	122241840	splice site	probably null
R2099:Tctn1	UTSW	5	122242709	missense	probably damaging	1.00
R4707:Tctn1	UTSW	5	122261405	critical splice donor site	probably null
R4836:Tctn1	UTSW	5	122245505	missense	probably benign
R6149:Tctn1	UTSW	5	122246586	missense	probably benign	0.01
R6358:Tctn1	UTSW	5	122261512	missense	probably damaging	0.99
R6629:Tctn1	UTSW	5	122242668	missense	probably damaging	1.00
R6744:Tctn1	UTSW	5	122264146	missense	probably damaging	1.00
R6899:Tctn1	UTSW	5	122248956	missense	probably damaging	0.98
R7332:Tctn1	UTSW	5	122261484	missense	probably damaging	1.00
R7576:Tctn1	UTSW	5	122248008	missense	probably damaging	1.00
R7883:Tctn1	UTSW	5	122264312	missense	possibly damaging	0.73
R7909:Tctn1	UTSW	5	122261410	missense	probably damaging	1.00
R8277:Tctn1	UTSW	5	122264368	start codon destroyed	probably null	0.95
R8465:Tctn1	UTSW	5	122241796	missense	probably benign	0.00
R8493:Tctn1	UTSW	5	122261489	missense	probably damaging	1.00
R8508:Tctn1	UTSW	5	122246611	missense	probably benign	0.09
R9146:Tctn1	UTSW	5	122251682	missense	possibly damaging	0.91
R9651:Tctn1	UTSW	5	122246513	missense	probably benign	0.18
R9764:Tctn1	UTSW	5	122250464	missense	possibly damaging	0.69
Z1088:Tctn1	UTSW	5	122251641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAAATCAGCCCTGGGGTTTG -3'
(R):5'- AAAGCCACATGGAGTCTCTGC -3'

Sequencing Primer
(F):5'- CCCTGGGGTTTGAATTATTCACACAG -3'
(R):5'- ATGGAGTCTCTGCTGACCTGAC -3'

Posted On

2016-09-01