Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Klf5'

428445

Institutional Source

Beutler Lab

Gene Symbol

Klf5

Ensembl Gene

ENSMUSG00000005148

Gene Name

Kruppel-like factor 5

Synonyms

IKLF, Bteb2, 4930520J07Rik, CKLF

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99298691-99315036 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 99301459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 23 (R23*)

Ref Sequence

ENSEMBL: ENSMUSP00000154786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005279] [ENSMUST00000226784]

AlphaFold

Q9Z0Z7

Predicted Effect

probably null
Transcript: ENSMUST00000005279
AA Change: R103*

SMART Domains

Protein: ENSMUSP00000005279
Gene: ENSMUSG00000005148
AA Change: R103*

Domain	Start	End	E-Value	Type
low complexity region	53	65	N/A	INTRINSIC
low complexity region	166	173	N/A	INTRINSIC
low complexity region	290	301	N/A	INTRINSIC
ZnF_C2H2	362	386	3.83e-2	SMART
ZnF_C2H2	392	416	2.47e-5	SMART
ZnF_C2H2	422	444	1.2e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000226784
AA Change: R23*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. The encoded protein is a transcriptional activator that binds directly to a specific recognition motif in the promoters of target genes. This protein acts downstream of multiple different signaling pathways and is regulated by post-translational modification. It may participate in both promoting and suppressing cell proliferation. Expression of this gene may be changed in a variety of different cancers and in cardiovascular disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice die during gestation, while heterozygotes exhibit abnormal cardiovascular remodeling after external stress. Mice homozygous for a floxed allele activated in the prostate exhibit increased cell proliferation and hyperplasia in the prostate without neoplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif13b	C	T	14: 64,806,114	R1788C	probably damaging	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Klf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Klf5	APN	14	99301721	missense	probably benign	0.01
IGL02380:Klf5	APN	14	99301458	missense	possibly damaging	0.67
Bernie	UTSW	14	99302230	missense	probably damaging	1.00
I0000:Klf5	UTSW	14	99303475	missense	probably damaging	1.00
R0133:Klf5	UTSW	14	99301882	missense	probably benign
R1672:Klf5	UTSW	14	99301550	missense	probably damaging	0.98
R1914:Klf5	UTSW	14	99301921	missense	probably benign	0.01
R2193:Klf5	UTSW	14	99298970	unclassified	probably benign
R3892:Klf5	UTSW	14	99299073	missense	probably benign	0.00
R4446:Klf5	UTSW	14	99302230	missense	probably damaging	1.00
R5707:Klf5	UTSW	14	99301508	missense	probably benign
R6475:Klf5	UTSW	14	99301381	missense	probably benign	0.00
R6552:Klf5	UTSW	14	99301642	missense	probably benign
R6982:Klf5	UTSW	14	99313235	missense	probably damaging	1.00
R7250:Klf5	UTSW	14	99299019	missense	probably benign	0.00
R7643:Klf5	UTSW	14	99313178	missense	possibly damaging	0.88
R7938:Klf5	UTSW	14	99299008	missense	probably damaging	0.98
R8272:Klf5	UTSW	14	99302104	missense	possibly damaging	0.67
R8396:Klf5	UTSW	14	99302234	missense	possibly damaging	0.95
R8898:Klf5	UTSW	14	99301486	missense	probably damaging	0.99
R9015:Klf5	UTSW	14	99303483	makesense	probably null
R9251:Klf5	UTSW	14	99301388	missense	possibly damaging	0.95
R9560:Klf5	UTSW	14	99301598	missense	probably benign	0.06
R9717:Klf5	UTSW	14	99301753	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCGTAGAGTCTTGGTTAACCG -3'
(R):5'- CTGGTGGCTGAAAATGGTAAC -3'

Sequencing Primer
(F):5'- TAAGCAACACTTAGGAGTTGGCCC -3'
(R):5'- AACAGGTTCTGTCTTGATCTGTG -3'

Posted On

2016-09-01