Incidental Mutation 'R5437:Ryr2'
ID 428440
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 043002-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5437 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 11553102-12106945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11655713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 3466 (V3466M)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021750
AA Change: V3466M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: V3466M

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170156
AA Change: V3466M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: V3466M

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221941
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 (GRCm38) Q186* probably null Het
Acaca G A 11: 84,346,820 (GRCm38) probably null Het
Acsm3 C A 7: 119,778,497 (GRCm38) probably benign Het
Aoc1 C A 6: 48,907,750 (GRCm38) Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 (GRCm38) N378I probably damaging Het
BC003331 T G 1: 150,363,518 (GRCm38) I385L probably benign Het
Cacna1i A T 15: 80,371,529 (GRCm38) H871L probably damaging Het
Clic4 C G 4: 135,217,246 (GRCm38) R206P probably damaging Het
Commd9 G A 2: 101,901,028 (GRCm38) G186D probably damaging Het
Cpne9 C T 6: 113,304,630 (GRCm38) probably benign Het
Crhr2 C T 6: 55,100,733 (GRCm38) V196I probably damaging Het
Dctn5 T A 7: 122,133,329 (GRCm38) probably benign Het
Dhtkd1 C T 2: 5,924,119 (GRCm38) R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 (GRCm38) G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 (GRCm38) Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 (GRCm38) N119K probably damaging Het
Eloa A T 4: 136,012,885 (GRCm38) L75Q probably damaging Het
Fat3 G A 9: 16,085,308 (GRCm38) T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 (GRCm38) I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 (GRCm38) D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 (GRCm38) F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 (GRCm38) C969S probably damaging Het
Hook3 T C 8: 26,061,422 (GRCm38) E130G probably benign Het
Itgb4 C T 11: 115,984,157 (GRCm38) R447W probably benign Het
Itsn1 T A 16: 91,818,591 (GRCm38) probably benign Het
Kif13b C T 14: 64,806,114 (GRCm38) R1788C probably damaging Het
Kif3a C T 11: 53,598,726 (GRCm38) S135F probably damaging Het
Klf5 C T 14: 99,301,459 (GRCm38) R23* probably null Het
Lcn5 A G 2: 25,658,011 (GRCm38) I11V probably benign Het
Mpp7 A T 18: 7,458,930 (GRCm38) probably null Het
Mroh5 T C 15: 73,787,969 (GRCm38) I338V probably benign Het
Mthfd2l A G 5: 90,948,898 (GRCm38) N126S possibly damaging Het
Myo18b G T 5: 112,757,573 (GRCm38) A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 (GRCm38) C318* probably null Het
Ndufs7 C T 10: 80,254,924 (GRCm38) R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 (GRCm38) M30T probably benign Het
Pnkd T C 1: 74,349,737 (GRCm38) V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 (GRCm38) V82G probably benign Het
Prkdc A T 16: 15,769,875 (GRCm38) L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 (GRCm38) H66L possibly damaging Het
Pygm T A 19: 6,390,382 (GRCm38) N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 (GRCm38) E324D probably damaging Het
Rnf6 G A 5: 146,210,280 (GRCm38) R643C probably damaging Het
Scn7a A G 2: 66,676,346 (GRCm38) Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 (GRCm38) N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 (GRCm38) Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 (GRCm38) T449A probably benign Het
Tcam1 C T 11: 106,285,423 (GRCm38) T325M probably damaging Het
Tctn1 A G 5: 122,258,879 (GRCm38) I147T probably benign Het
Tet1 G T 10: 62,814,451 (GRCm38) H30Q probably benign Het
Tmem109 A G 19: 10,872,014 (GRCm38) I159T probably damaging Het
Tmem40 C T 6: 115,759,031 (GRCm38) probably benign Het
Tnfrsf21 C T 17: 43,037,862 (GRCm38) P122S possibly damaging Het
Uaca A G 9: 60,871,451 (GRCm38) D1038G probably benign Het
Ubr2 C G 17: 46,963,697 (GRCm38) E852D probably benign Het
Ubr3 A T 2: 69,944,390 (GRCm38) N518I probably damaging Het
Unc80 T G 1: 66,654,578 (GRCm38) L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 (GRCm38) P16S probably benign Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,834,092 (GRCm38) splice site probably benign
IGL00757:Ryr2 APN 13 11,618,604 (GRCm38) splice site probably null
IGL00838:Ryr2 APN 13 11,568,503 (GRCm38) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,585,478 (GRCm38) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,735,502 (GRCm38) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,703,544 (GRCm38) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,638,485 (GRCm38) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,587,239 (GRCm38) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,556,685 (GRCm38) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,591,352 (GRCm38) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,742,036 (GRCm38) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,799,837 (GRCm38) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,851,204 (GRCm38) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,721,790 (GRCm38) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,721,761 (GRCm38) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,601,758 (GRCm38) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,591,316 (GRCm38) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,594,968 (GRCm38) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,692,677 (GRCm38) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,585,480 (GRCm38) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,601,842 (GRCm38) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,595,425 (GRCm38) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,554,550 (GRCm38) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,597,112 (GRCm38) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,747,564 (GRCm38) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,572,257 (GRCm38) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,792,762 (GRCm38) nonsense probably null
IGL02086:Ryr2 APN 13 11,735,556 (GRCm38) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,759,759 (GRCm38) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,737,873 (GRCm38) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,741,869 (GRCm38) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,730,388 (GRCm38) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,747,658 (GRCm38) splice site probably benign
IGL02369:Ryr2 APN 13 11,619,496 (GRCm38) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,722,721 (GRCm38) splice site probably benign
IGL02400:Ryr2 APN 13 11,605,244 (GRCm38) splice site probably benign
IGL02423:Ryr2 APN 13 11,745,198 (GRCm38) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,745,674 (GRCm38) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,705,699 (GRCm38) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,554,511 (GRCm38) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,605,189 (GRCm38) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,738,320 (GRCm38) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,655,677 (GRCm38) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,595,190 (GRCm38) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,707,793 (GRCm38) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,918,319 (GRCm38) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,591,269 (GRCm38) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,759,835 (GRCm38) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,684,479 (GRCm38) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,643,902 (GRCm38) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,635,582 (GRCm38) splice site probably benign
IGL03152:Ryr2 APN 13 11,853,150 (GRCm38) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,742,023 (GRCm38) nonsense probably null
IGL03180:Ryr2 APN 13 11,568,563 (GRCm38) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,724,387 (GRCm38) splice site probably benign
IGL03390:Ryr2 APN 13 11,772,416 (GRCm38) missense probably benign
IGL03410:Ryr2 APN 13 11,588,147 (GRCm38) missense probably damaging 0.99
Arruda UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
Arruda2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
Arruda3 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
barricuda UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB006:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB016:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,717,141 (GRCm38) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,665,962 (GRCm38) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,761,306 (GRCm38) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,707,796 (GRCm38) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,594,755 (GRCm38) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,555,448 (GRCm38) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,824,379 (GRCm38) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,665,919 (GRCm38) missense probably benign
R0018:Ryr2 UTSW 13 11,595,223 (GRCm38) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,669,038 (GRCm38) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,568,475 (GRCm38) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,709,921 (GRCm38) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,714,548 (GRCm38) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,676,251 (GRCm38) splice site probably benign
R0226:Ryr2 UTSW 13 11,772,556 (GRCm38) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,716,977 (GRCm38) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,668,839 (GRCm38) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,705,684 (GRCm38) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,834,095 (GRCm38) splice site probably benign
R0558:Ryr2 UTSW 13 11,799,861 (GRCm38) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,638,443 (GRCm38) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,731,669 (GRCm38) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,635,559 (GRCm38) missense probably null
R0601:Ryr2 UTSW 13 11,705,633 (GRCm38) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,622,952 (GRCm38) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,724,333 (GRCm38) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,566,885 (GRCm38) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,738,126 (GRCm38) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,669,969 (GRCm38) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,945,981 (GRCm38) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,660,113 (GRCm38) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,883,043 (GRCm38) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,687,879 (GRCm38) splice site probably benign
R1400:Ryr2 UTSW 13 11,595,076 (GRCm38) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,714,503 (GRCm38) splice site probably benign
R1443:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,738,149 (GRCm38) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,727,022 (GRCm38) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,601,841 (GRCm38) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,554,592 (GRCm38) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,554,549 (GRCm38) nonsense probably null
R1551:Ryr2 UTSW 13 11,785,143 (GRCm38) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,759,677 (GRCm38) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,794,563 (GRCm38) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,718,482 (GRCm38) nonsense probably null
R1686:Ryr2 UTSW 13 11,603,779 (GRCm38) splice site probably benign
R1696:Ryr2 UTSW 13 11,731,657 (GRCm38) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,587,442 (GRCm38) splice site probably null
R1728:Ryr2 UTSW 13 11,587,422 (GRCm38) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,790,267 (GRCm38) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,700,371 (GRCm38) nonsense probably null
R1801:Ryr2 UTSW 13 11,595,281 (GRCm38) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,560,586 (GRCm38) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,587,316 (GRCm38) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,769,878 (GRCm38) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,731,700 (GRCm38) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,662,075 (GRCm38) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,738,356 (GRCm38) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,658,958 (GRCm38) nonsense probably null
R1897:Ryr2 UTSW 13 11,750,932 (GRCm38) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,591,336 (GRCm38) missense probably benign
R1909:Ryr2 UTSW 13 11,700,349 (GRCm38) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,556,698 (GRCm38) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,731,723 (GRCm38) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,681,080 (GRCm38) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,585,402 (GRCm38) splice site probably null
R2018:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,595,736 (GRCm38) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,665,878 (GRCm38) splice site probably null
R2088:Ryr2 UTSW 13 11,662,229 (GRCm38) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,712,195 (GRCm38) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,560,607 (GRCm38) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,577,873 (GRCm38) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,705,793 (GRCm38) nonsense probably null
R2207:Ryr2 UTSW 13 11,810,937 (GRCm38) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,662,260 (GRCm38) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,738,216 (GRCm38) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,738,242 (GRCm38) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,591,237 (GRCm38) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,801,848 (GRCm38) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,772,580 (GRCm38) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,588,159 (GRCm38) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,738,209 (GRCm38) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,772,427 (GRCm38) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,918,414 (GRCm38) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,692,682 (GRCm38) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,779,267 (GRCm38) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,587,437 (GRCm38) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,737,873 (GRCm38) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,750,725 (GRCm38) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,649,812 (GRCm38) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,605,233 (GRCm38) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,717,066 (GRCm38) nonsense probably null
R4430:Ryr2 UTSW 13 11,735,527 (GRCm38) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,106,415 (GRCm38) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,749,509 (GRCm38) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,750,685 (GRCm38) splice site probably null
R4668:Ryr2 UTSW 13 11,593,117 (GRCm38) missense probably benign
R4677:Ryr2 UTSW 13 11,706,667 (GRCm38) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,824,369 (GRCm38) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,595,233 (GRCm38) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,692,646 (GRCm38) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,716,998 (GRCm38) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,737,753 (GRCm38) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,657,047 (GRCm38) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,717,097 (GRCm38) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,655,698 (GRCm38) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,745,752 (GRCm38) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,668,820 (GRCm38) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,752,218 (GRCm38) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,709,963 (GRCm38) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,945,945 (GRCm38) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,742,011 (GRCm38) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,785,080 (GRCm38) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,595,306 (GRCm38) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,587,254 (GRCm38) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,635,536 (GRCm38) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,700,354 (GRCm38) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,712,243 (GRCm38) nonsense probably null
R5135:Ryr2 UTSW 13 11,662,130 (GRCm38) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,660,289 (GRCm38) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,752,321 (GRCm38) missense probably benign
R5187:Ryr2 UTSW 13 11,772,452 (GRCm38) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,638,430 (GRCm38) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,772,437 (GRCm38) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,690,363 (GRCm38) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,556,658 (GRCm38) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,705,656 (GRCm38) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,705,701 (GRCm38) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,687,909 (GRCm38) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,708,202 (GRCm38) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,601,805 (GRCm38) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,595,582 (GRCm38) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,759,836 (GRCm38) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,769,962 (GRCm38) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,560,574 (GRCm38) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,584,154 (GRCm38) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,790,332 (GRCm38) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,687,902 (GRCm38) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,660,122 (GRCm38) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,726,953 (GRCm38) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,662,238 (GRCm38) nonsense probably null
R5974:Ryr2 UTSW 13 11,714,511 (GRCm38) splice site probably null
R6104:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,792,689 (GRCm38) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,669,017 (GRCm38) missense probably benign
R6208:Ryr2 UTSW 13 11,895,220 (GRCm38) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,834,078 (GRCm38) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,660,107 (GRCm38) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,761,396 (GRCm38) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,662,383 (GRCm38) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,834,007 (GRCm38) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,668,821 (GRCm38) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,710,065 (GRCm38) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,595,643 (GRCm38) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,738,462 (GRCm38) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,686,966 (GRCm38) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,726,930 (GRCm38) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,829,654 (GRCm38) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,827,559 (GRCm38) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,566,948 (GRCm38) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,801,243 (GRCm38) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,654,380 (GRCm38) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,712,166 (GRCm38) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,794,605 (GRCm38) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,824,400 (GRCm38) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,649,776 (GRCm38) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,669,987 (GRCm38) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,668,811 (GRCm38) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,640,327 (GRCm38) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,810,908 (GRCm38) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,801,177 (GRCm38) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,686,978 (GRCm38) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,759,757 (GRCm38) missense probably benign
R7189:Ryr2 UTSW 13 11,883,123 (GRCm38) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,665,913 (GRCm38) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,597,146 (GRCm38) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,738,194 (GRCm38) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,745,631 (GRCm38) missense probably benign
R7365:Ryr2 UTSW 13 11,640,275 (GRCm38) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,785,111 (GRCm38) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,735,620 (GRCm38) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,556,748 (GRCm38) splice site probably null
R7425:Ryr2 UTSW 13 11,705,644 (GRCm38) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,555,463 (GRCm38) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,752,282 (GRCm38) missense probably benign
R7460:Ryr2 UTSW 13 11,705,710 (GRCm38) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,594,876 (GRCm38) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,638,431 (GRCm38) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,737,985 (GRCm38) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,560,653 (GRCm38) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,761,327 (GRCm38) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,761,315 (GRCm38) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,690,333 (GRCm38) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,730,343 (GRCm38) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,751,011 (GRCm38) missense probably benign
R7797:Ryr2 UTSW 13 11,801,180 (GRCm38) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,827,607 (GRCm38) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,706,623 (GRCm38) nonsense probably null
R7872:Ryr2 UTSW 13 11,595,724 (GRCm38) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,792,748 (GRCm38) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
R7952:Ryr2 UTSW 13 11,646,427 (GRCm38) splice site probably null
R8008:Ryr2 UTSW 13 11,657,094 (GRCm38) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,588,140 (GRCm38) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,945,995 (GRCm38) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,603,698 (GRCm38) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,827,553 (GRCm38) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,595,506 (GRCm38) nonsense probably null
R8351:Ryr2 UTSW 13 11,799,832 (GRCm38) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,668,935 (GRCm38) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,684,478 (GRCm38) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,659,008 (GRCm38) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,577,778 (GRCm38) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,560,593 (GRCm38) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,687,989 (GRCm38) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,686,947 (GRCm38) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,668,969 (GRCm38) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,735,623 (GRCm38) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,558,048 (GRCm38) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,785,104 (GRCm38) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,799,882 (GRCm38) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,595,038 (GRCm38) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,594,786 (GRCm38) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,738,103 (GRCm38) nonsense probably null
R9056:Ryr2 UTSW 13 11,595,931 (GRCm38) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,601,838 (GRCm38) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,603,855 (GRCm38) intron probably benign
R9116:Ryr2 UTSW 13 11,572,299 (GRCm38) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,654,406 (GRCm38) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,885,538 (GRCm38) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,595,886 (GRCm38) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,750,968 (GRCm38) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,706,692 (GRCm38) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,681,087 (GRCm38) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,794,573 (GRCm38) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,772,577 (GRCm38) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,737,794 (GRCm38) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,556,604 (GRCm38) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,587,215 (GRCm38) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,745,218 (GRCm38) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,722,760 (GRCm38) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,687,049 (GRCm38) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,594,899 (GRCm38) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,692,713 (GRCm38) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,703,501 (GRCm38) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,643,803 (GRCm38) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,598,611 (GRCm38) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,794,549 (GRCm38) nonsense probably null
Z1177:Ryr2 UTSW 13 11,750,873 (GRCm38) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CGCAGTCATTGGTTTAAGGCC -3'
(R):5'- TGGGAAGGAAAGATAACCTTTTCAG -3'

Sequencing Primer
(F):5'- GTTTAAGGCCTAGGCTCTACAG -3'
(R):5'- GGTTAGGATTTCTGAAAATAGGGATC -3'
Posted On 2016-09-01