Mutagenetix > Incidental Mutation

Incidental Mutation 'R5437:Kif13b'

428444

Institutional Source

Beutler Lab

Gene Symbol

Kif13b

Ensembl Gene

ENSMUSG00000060012

Gene Name

kinesin family member 13B

Synonyms

N-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN

MMRRC Submission

043002-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64647265-64809617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64806114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1788 (R1788C)

Ref Sequence

ENSEMBL: ENSMUSP00000153168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]

AlphaFold

A0A286YCV9

Predicted Effect

probably damaging
Transcript: ENSMUST00000100473
AA Change: R1784C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012
AA Change: R1784C

Domain	Start	End	E-Value	Type
KISc	3	361	1.4e-182	SMART
FHA	470	520	6.86e-1	SMART
low complexity region	546	560	N/A	INTRINSIC
coiled coil region	617	646	N/A	INTRINSIC
coiled coil region	669	701	N/A	INTRINSIC
Pfam:KIF1B	756	802	4.1e-20	PFAM
Pfam:DUF3694	1003	1279	1.4e-37	PFAM
low complexity region	1514	1526	N/A	INTRINSIC
low complexity region	1532	1548	N/A	INTRINSIC
low complexity region	1574	1589	N/A	INTRINSIC
low complexity region	1617	1630	N/A	INTRINSIC
CAP_GLY	1719	1784	1.54e-29	SMART
low complexity region	1814	1826	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224503
AA Change: R1788C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224677

Meta Mutation Damage Score

0.3929

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	G	A	11: 110,319,796	Q186*	probably null	Het
Acaca	G	A	11: 84,346,820		probably null	Het
Acsm3	C	A	7: 119,778,497		probably benign	Het
Aoc1	C	A	6: 48,907,750	Q576K	probably benign	Het
Atp6v0a4	T	A	6: 38,076,733	N378I	probably damaging	Het
BC003331	T	G	1: 150,363,518	I385L	probably benign	Het
Cacna1i	A	T	15: 80,371,529	H871L	probably damaging	Het
Clic4	C	G	4: 135,217,246	R206P	probably damaging	Het
Commd9	G	A	2: 101,901,028	G186D	probably damaging	Het
Cpne9	C	T	6: 113,304,630		probably benign	Het
Crhr2	C	T	6: 55,100,733	V196I	probably damaging	Het
Dctn5	T	A	7: 122,133,329		probably benign	Het
Dhtkd1	C	T	2: 5,924,119	R247Q	probably benign	Het
Dmrta1	G	A	4: 89,691,756	G318R	possibly damaging	Het
Dpp6	T	A	5: 27,663,501	Y487*	probably null	Het
Eef1akmt3	A	T	10: 127,033,247	N119K	probably damaging	Het
Eloa	A	T	4: 136,012,885	L75Q	probably damaging	Het
Fat3	G	A	9: 16,085,308	T1202M	probably damaging	Het
Fcho2	A	G	13: 98,777,474	I205T	possibly damaging	Het
Fkbp10	A	C	11: 100,421,023	D174A	probably damaging	Het
Gcnt2	T	A	13: 40,861,176	F274L	probably damaging	Het
Gtf3c1	A	T	7: 125,667,368	C969S	probably damaging	Het
Hook3	T	C	8: 26,061,422	E130G	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Itsn1	T	A	16: 91,818,591		probably benign	Het
Kif3a	C	T	11: 53,598,726	S135F	probably damaging	Het
Klf5	C	T	14: 99,301,459	R23*	probably null	Het
Lcn5	A	G	2: 25,658,011	I11V	probably benign	Het
Mpp7	A	T	18: 7,458,930		probably null	Het
Mroh5	T	C	15: 73,787,969	I338V	probably benign	Het
Mthfd2l	A	G	5: 90,948,898	N126S	possibly damaging	Het
Myo18b	G	T	5: 112,757,573	A2053E	possibly damaging	Het
Naip6	A	T	13: 100,303,304	C318*	probably null	Het
Ndufs7	C	T	10: 80,254,924	R116C	possibly damaging	Het
Olfr1378	T	C	11: 50,969,108	M30T	probably benign	Het
Pnkd	T	C	1: 74,349,737	V214A	possibly damaging	Het
Popdc2	T	G	16: 38,362,901	V82G	probably benign	Het
Prkdc	A	T	16: 15,769,875	L2541F	possibly damaging	Het
Ptpn9	A	T	9: 57,020,037	H66L	possibly damaging	Het
Pygm	T	A	19: 6,390,382	N397K	probably damaging	Het
Rabgap1l	T	A	1: 160,722,147	E324D	probably damaging	Het
Rnf6	G	A	5: 146,210,280	R643C	probably damaging	Het
Ryr2	C	T	13: 11,655,713	V3466M	probably damaging	Het
Scn7a	A	G	2: 66,676,346	Y1400H	probably damaging	Het
Sept10	T	A	10: 59,176,959	N279I	probably damaging	Het
Sh3rf2	A	T	18: 42,141,014	Y415F	probably benign	Het
Sorcs1	T	C	19: 50,252,602	T449A	probably benign	Het
Tcam1	C	T	11: 106,285,423	T325M	probably damaging	Het
Tctn1	A	G	5: 122,258,879	I147T	probably benign	Het
Tet1	G	T	10: 62,814,451	H30Q	probably benign	Het
Tmem109	A	G	19: 10,872,014	I159T	probably damaging	Het
Tmem40	C	T	6: 115,759,031		probably benign	Het
Tnfrsf21	C	T	17: 43,037,862	P122S	possibly damaging	Het
Uaca	A	G	9: 60,871,451	D1038G	probably benign	Het
Ubr2	C	G	17: 46,963,697	E852D	probably benign	Het
Ubr3	A	T	2: 69,944,390	N518I	probably damaging	Het
Unc80	T	G	1: 66,654,578	L2596R	possibly damaging	Het
Zcchc3	G	A	2: 152,414,732	P16S	probably benign	Het

Other mutations in Kif13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Kif13b	APN	14	64669693	missense	possibly damaging	0.81
IGL00485:Kif13b	APN	14	64765073	missense	possibly damaging	0.88
IGL00495:Kif13b	APN	14	64714113	missense	probably benign	0.07
IGL00556:Kif13b	APN	14	64744888	missense	probably damaging	1.00
IGL00571:Kif13b	APN	14	64746417	missense	probably damaging	0.99
IGL00590:Kif13b	APN	14	64779462	missense	probably damaging	1.00
IGL01650:Kif13b	APN	14	64765145	missense	probably benign	0.00
IGL01730:Kif13b	APN	14	64750361	critical splice donor site	probably null
IGL01908:Kif13b	APN	14	64757558	missense	probably damaging	1.00
IGL02388:Kif13b	APN	14	64800358	missense	probably damaging	1.00
IGL02573:Kif13b	APN	14	64803431	missense	probably damaging	1.00
IGL02661:Kif13b	APN	14	64767691	missense	probably benign	0.06
IGL02794:Kif13b	APN	14	64803440	missense	probably benign	0.00
IGL02959:Kif13b	APN	14	64767717	missense	probably damaging	1.00
IGL02979:Kif13b	APN	14	64789697	missense	probably damaging	0.96
IGL03114:Kif13b	APN	14	64788448	missense	probably benign	0.00
R0024:Kif13b	UTSW	14	64750273	missense	probably benign	0.30
R0330:Kif13b	UTSW	14	64803220	missense	probably benign
R0376:Kif13b	UTSW	14	64757404	splice site	probably benign
R0571:Kif13b	UTSW	14	64751528	missense	probably damaging	1.00
R0718:Kif13b	UTSW	14	64751662	splice site	probably benign
R1144:Kif13b	UTSW	14	64714117	missense	probably benign	0.01
R1183:Kif13b	UTSW	14	64782377	missense	probably benign	0.00
R1264:Kif13b	UTSW	14	64776232	splice site	probably benign
R1497:Kif13b	UTSW	14	64736266	missense	probably damaging	0.99
R1579:Kif13b	UTSW	14	64782341	critical splice acceptor site	probably null
R1624:Kif13b	UTSW	14	64738619	missense	probably damaging	0.99
R1706:Kif13b	UTSW	14	64760666	splice site	probably benign
R2176:Kif13b	UTSW	14	64669671	missense	probably benign	0.01
R3727:Kif13b	UTSW	14	64765748	splice site	probably benign
R3785:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R3786:Kif13b	UTSW	14	64800400	missense	probably benign	0.00
R4088:Kif13b	UTSW	14	64767455	critical splice donor site	probably null
R4279:Kif13b	UTSW	14	64779356	missense	probably damaging	1.00
R4559:Kif13b	UTSW	14	64806132	missense	probably damaging	0.98
R4689:Kif13b	UTSW	14	64773064	missense	probably damaging	1.00
R4692:Kif13b	UTSW	14	64803575	missense	probably benign	0.05
R4878:Kif13b	UTSW	14	64806154	missense	probably benign	0.00
R4971:Kif13b	UTSW	14	64757562	missense	possibly damaging	0.90
R5037:Kif13b	UTSW	14	64758589	nonsense	probably null
R5119:Kif13b	UTSW	14	64757453	missense	probably benign	0.01
R5167:Kif13b	UTSW	14	64772935	missense	probably damaging	1.00
R5408:Kif13b	UTSW	14	64779689	critical splice acceptor site	probably null
R5756:Kif13b	UTSW	14	64736305	missense	probably damaging	1.00
R5838:Kif13b	UTSW	14	64737555	missense	probably damaging	1.00
R5891:Kif13b	UTSW	14	64788405	splice site	probably null
R6120:Kif13b	UTSW	14	64751558	missense	probably damaging	1.00
R6150:Kif13b	UTSW	14	64751639	missense	probably damaging	0.99
R6165:Kif13b	UTSW	14	64742311	missense	probably damaging	1.00
R6187:Kif13b	UTSW	14	64736215	missense	probably damaging	1.00
R6229:Kif13b	UTSW	14	64738567	missense	probably damaging	1.00
R6267:Kif13b	UTSW	14	64738634	missense	probably damaging	1.00
R6347:Kif13b	UTSW	14	64767619	missense	probably benign	0.26
R6479:Kif13b	UTSW	14	64751525	missense	probably benign	0.08
R6512:Kif13b	UTSW	14	64744874	critical splice acceptor site	probably null
R6851:Kif13b	UTSW	14	64773065	missense	probably damaging	1.00
R7131:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7217:Kif13b	UTSW	14	64773068	missense	probably damaging	1.00
R7398:Kif13b	UTSW	14	64757523	missense	probably null	0.02
R7427:Kif13b	UTSW	14	64788460	missense	probably benign
R7428:Kif13b	UTSW	14	64788460	missense	probably benign
R7573:Kif13b	UTSW	14	64803658	missense	probably benign	0.00
R7629:Kif13b	UTSW	14	64779335	nonsense	probably null
R7683:Kif13b	UTSW	14	64757507	missense	probably benign	0.24
R7835:Kif13b	UTSW	14	64767452	missense	probably benign	0.00
R7895:Kif13b	UTSW	14	64736149	missense	probably damaging	1.00
R8285:Kif13b	UTSW	14	64782376	missense	probably benign	0.03
R8374:Kif13b	UTSW	14	64788435	missense	probably damaging	0.97
R8467:Kif13b	UTSW	14	64758705	missense	probably damaging	0.96
R8804:Kif13b	UTSW	14	64750342	missense	probably damaging	0.99
R8859:Kif13b	UTSW	14	64742433	missense	probably benign	0.04
R8891:Kif13b	UTSW	14	64744877	missense	probably damaging	1.00
R9236:Kif13b	UTSW	14	64744934	missense	probably benign	0.22
R9446:Kif13b	UTSW	14	64747021	missense	probably damaging	1.00
R9589:Kif13b	UTSW	14	64776310	missense	possibly damaging	0.82
Z1176:Kif13b	UTSW	14	64803344	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAACGACTGGTTGCTGTCCTG -3'
(R):5'- GACTTCCGGTTCTCAGGATTC -3'

Sequencing Primer
(F):5'- AGAGGCTACTGTTCTGGGCAC -3'
(R):5'- CCGGTTCTCAGGATTCTTGTAAC -3'

Posted On

2016-09-01