Incidental Mutation 'R5500:Slc45a2'
ID430579
Institutional Source Beutler Lab
Gene Symbol Slc45a2
Ensembl Gene ENSMUSG00000022243
Gene Namesolute carrier family 45, member 2
Synonymsblanc-sale, Oca4, dominant brown, Dbr, bls, Aim1, Aim-1, Matp
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location11000721-11029233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11027785 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 480 (T480I)
Ref Sequence ENSEMBL: ENSMUSP00000112408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022851
AA Change: T480I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022851
Gene: ENSMUSG00000022243
AA Change: T480I

DomainStartEndE-ValueType
Pfam:MFS_2 34 262 2.4e-17 PFAM
Pfam:MFS_1 36 363 3e-13 PFAM
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117100
AA Change: T480I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112408
Gene: ENSMUSG00000022243
AA Change: T480I

DomainStartEndE-ValueType
Pfam:MFS_2 1 457 2e-22 PFAM
Pfam:MFS_1 2 292 2.6e-12 PFAM
Meta Mutation Damage Score 0.1786 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Slc45a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Slc45a2 APN 15 11000817 start codon destroyed probably null 0.80
IGL02283:Slc45a2 APN 15 11001182 missense probably damaging 1.00
IGL02634:Slc45a2 APN 15 11023354 missense probably benign 0.21
IGL03039:Slc45a2 APN 15 11012687 missense probably benign
IGL03123:Slc45a2 APN 15 11012655 missense probably benign 0.01
IGL03226:Slc45a2 APN 15 11022192 missense probably damaging 1.00
cardigan UTSW 15 11022172 synonymous probably benign
cheng UTSW 15 11025868 missense probably damaging 0.99
Draco2 UTSW 15 11000817 start codon destroyed probably benign 0.05
galak UTSW 15 11012667 missense probably benign
goku UTSW 15 11000855 nonsense probably null
grey_goose UTSW 15 11002981 missense probably damaging 1.00
june_gloom UTSW 15 11023443 missense possibly damaging 0.94
nilla UTSW 15 splice donor site
Olaf UTSW 15 unclassified
sweater UTSW 15 11012610 missense probably damaging 1.00
voldemort UTSW 15 unclassified
yuki UTSW 15 11001092 missense probably damaging 1.00
zuckerkuss UTSW 15 11025935 critical splice donor site probably benign
R0148:Slc45a2 UTSW 15 11025868 missense probably damaging 0.99
R0433:Slc45a2 UTSW 15 11025745 missense probably benign 0.17
R0440:Slc45a2 UTSW 15 11000817 start codon destroyed probably benign 0.05
R0675:Slc45a2 UTSW 15 11025778 missense probably damaging 1.00
R1384:Slc45a2 UTSW 15 11025746 missense probably benign 0.04
R1616:Slc45a2 UTSW 15 11022128 missense probably null 0.01
R1824:Slc45a2 UTSW 15 11022086 missense probably damaging 0.99
R2244:Slc45a2 UTSW 15 11003001 missense probably benign 0.21
R3761:Slc45a2 UTSW 15 11012714 missense probably benign 0.07
R4631:Slc45a2 UTSW 15 11012576 missense probably benign 0.13
R4756:Slc45a2 UTSW 15 11027930 nonsense probably null
R4990:Slc45a2 UTSW 15 11001150 missense probably benign 0.00
R5066:Slc45a2 UTSW 15 11012607 missense probably benign 0.31
R5209:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5210:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5211:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5212:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5213:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5259:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5261:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5390:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5394:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5395:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5422:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5496:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5498:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5499:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5501:Slc45a2 UTSW 15 11027785 missense probably damaging 0.98
R5649:Slc45a2 UTSW 15 11012607 missense probably benign 0.00
R5662:Slc45a2 UTSW 15 11022083 missense probably benign 0.31
R5696:Slc45a2 UTSW 15 11001133 missense probably damaging 1.00
R5896:Slc45a2 UTSW 15 11000855 nonsense probably null
R6236:Slc45a2 UTSW 15 11022072 missense probably benign 0.00
R6709:Slc45a2 UTSW 15 11001130 missense possibly damaging 0.46
R7243:Slc45a2 UTSW 15 11023350 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAAGGCTTTCTGGAGCTGTG -3'
(R):5'- AGAGCGGTTTCTTGCCATGG -3'

Sequencing Primer
(F):5'- CTGTGAGAGCAGAGGCAAATAATTAC -3'
(R):5'- CCATGGGCTTCTTTTGTCTGAG -3'
Posted On2016-10-05