Incidental Mutation 'R5491:Or4f56'
ID 432072
Institutional Source Beutler Lab
Gene Symbol Or4f56
Ensembl Gene ENSMUSG00000074955
Gene Name olfactory receptor family 4 subfamily F member 56
Synonyms MOR245-8, Olfr1305, GA_x6K02T2Q125-72930843-72929905
MMRRC Submission 043052-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R5491 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111703260-111704198 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111703907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 98 (I98F)
Ref Sequence ENSEMBL: ENSMUSP00000149852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099608] [ENSMUST00000213405] [ENSMUST00000213737]
AlphaFold A2AVW3
Predicted Effect probably benign
Transcript: ENSMUST00000099608
AA Change: I98F

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097203
Gene: ENSMUSG00000074955
AA Change: I98F

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-41 PFAM
Pfam:7TM_GPCR_Srsx 35 302 6.8e-7 PFAM
Pfam:7tm_1 41 287 4.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213405
AA Change: I98F

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000213737
AA Change: I98F

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216310
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf G T 19: 31,895,462 (GRCm39) A182S possibly damaging Het
Aldh1l2 A T 10: 83,358,649 (GRCm39) D2E probably benign Het
Bach2 G T 4: 32,562,681 (GRCm39) D383Y probably damaging Het
Cd248 T C 19: 5,120,237 (GRCm39) L695P probably damaging Het
Cela1 T A 15: 100,580,861 (GRCm39) N132Y probably damaging Het
Cisd2 A T 3: 135,114,601 (GRCm39) D123E probably damaging Het
Col6a6 T A 9: 105,615,435 (GRCm39) D1571V probably damaging Het
Eif4a3l1 C G 6: 136,306,555 (GRCm39) R339G probably damaging Het
Fbxo48 C T 11: 16,904,280 (GRCm39) T144M probably damaging Het
Fbxo7 C A 10: 85,883,890 (GRCm39) P497Q probably damaging Het
Garin5b T C 7: 4,760,925 (GRCm39) I596V probably benign Het
Gm12695 T A 4: 96,657,905 (GRCm39) H88L possibly damaging Het
Gpat4 A G 8: 23,670,680 (GRCm39) I133T probably benign Het
Hmcn1 C T 1: 150,485,576 (GRCm39) probably null Het
Ncaph T C 2: 126,965,595 (GRCm39) T252A probably benign Het
Nebl G T 2: 17,439,783 (GRCm39) Y163* probably null Het
Neurod4 C T 10: 130,106,936 (GRCm39) V113I possibly damaging Het
Or13j1 A G 4: 43,705,990 (GRCm39) S193P probably damaging Het
Or3a1d A T 11: 74,237,740 (GRCm39) H103Q probably benign Het
Pbxip1 T A 3: 89,350,466 (GRCm39) M37K probably benign Het
Phactr2 T C 10: 13,137,590 (GRCm39) N184S possibly damaging Het
Phf20l1 C T 15: 66,487,634 (GRCm39) P480L possibly damaging Het
Psme4 T C 11: 30,765,246 (GRCm39) S538P possibly damaging Het
Rassf1 T A 9: 107,438,614 (GRCm39) M228K possibly damaging Het
Rpn2 A G 2: 157,139,303 (GRCm39) D231G probably damaging Het
She A T 3: 89,739,097 (GRCm39) D96V probably damaging Het
Shisal1 C A 15: 84,290,711 (GRCm39) V199L probably benign Het
Tmem260 T A 14: 48,749,627 (GRCm39) probably null Het
Ttn T A 2: 76,562,702 (GRCm39) I28751F probably damaging Het
Zfp60 T G 7: 27,447,940 (GRCm39) probably null Het
Other mutations in Or4f56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Or4f56 APN 2 111,703,295 (GRCm39) missense probably benign 0.03
IGL02198:Or4f56 APN 2 111,703,593 (GRCm39) missense probably damaging 1.00
IGL02277:Or4f56 APN 2 111,703,925 (GRCm39) missense possibly damaging 0.91
IGL02302:Or4f56 APN 2 111,703,887 (GRCm39) missense possibly damaging 0.76
IGL03348:Or4f56 APN 2 111,703,493 (GRCm39) missense probably damaging 0.99
PIT4131001:Or4f56 UTSW 2 111,703,649 (GRCm39) missense probably benign 0.02
R2144:Or4f56 UTSW 2 111,703,768 (GRCm39) missense probably damaging 0.96
R2860:Or4f56 UTSW 2 111,703,818 (GRCm39) nonsense probably null
R2861:Or4f56 UTSW 2 111,703,818 (GRCm39) nonsense probably null
R3785:Or4f56 UTSW 2 111,703,831 (GRCm39) missense probably damaging 0.99
R4474:Or4f56 UTSW 2 111,703,784 (GRCm39) missense possibly damaging 0.52
R4508:Or4f56 UTSW 2 111,703,947 (GRCm39) missense probably damaging 1.00
R4540:Or4f56 UTSW 2 111,703,546 (GRCm39) missense probably damaging 1.00
R4783:Or4f56 UTSW 2 111,703,395 (GRCm39) missense possibly damaging 0.95
R4784:Or4f56 UTSW 2 111,703,395 (GRCm39) missense possibly damaging 0.95
R4785:Or4f56 UTSW 2 111,703,395 (GRCm39) missense possibly damaging 0.95
R5410:Or4f56 UTSW 2 111,703,637 (GRCm39) missense probably damaging 1.00
R6875:Or4f56 UTSW 2 111,703,306 (GRCm39) missense possibly damaging 0.92
R7185:Or4f56 UTSW 2 111,704,167 (GRCm39) missense possibly damaging 0.89
R7992:Or4f56 UTSW 2 111,703,280 (GRCm39) missense probably benign
R9100:Or4f56 UTSW 2 111,703,606 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATGAGACCAATGATCCAAGCAG -3'
(R):5'- TTGGGGCTCTCAAATTCCTGG -3'

Sequencing Primer
(F):5'- GCAGCAACTAATATTAGCAGGC -3'
(R):5'- CCAGTTTGACAGGAAACTTCATC -3'
Posted On 2016-10-05