Incidental Mutation 'R5491:Olfr411'
ID432093
Institutional Source Beutler Lab
Gene Symbol Olfr411
Ensembl Gene ENSMUSG00000054406
Gene Nameolfactory receptor 411
SynonymsMOR255-3, GA_x6K02T2P1NL-4481525-4480578
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5491 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74345129-74352650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74346914 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 103 (H103Q)
Ref Sequence ENSEMBL: ENSMUSP00000145878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080365] [ENSMUST00000141134] [ENSMUST00000214769]
Predicted Effect probably benign
Transcript: ENSMUST00000080365
AA Change: H223Q

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079235
Gene: ENSMUSG00000054406
AA Change: H223Q

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-58 PFAM
Pfam:7tm_1 44 293 8.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141134
AA Change: H103Q

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214769
AA Change: H223Q

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Olfr411
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr411 APN 11 74347429 missense probably benign 0.00
IGL01308:Olfr411 APN 11 74346660 missense probably damaging 1.00
IGL01596:Olfr411 APN 11 74347419 missense possibly damaging 0.79
IGL02233:Olfr411 APN 11 74347428 missense possibly damaging 0.51
IGL03407:Olfr411 APN 11 74347545 missense possibly damaging 0.47
R0371:Olfr411 UTSW 11 74346934 missense probably damaging 0.99
R0924:Olfr411 UTSW 11 74346798 missense probably damaging 1.00
R0926:Olfr411 UTSW 11 74347306 missense probably benign 0.00
R1265:Olfr411 UTSW 11 74346940 missense probably benign 0.00
R3712:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4446:Olfr411 UTSW 11 74346762 missense probably benign 0.12
R4669:Olfr411 UTSW 11 74346963 missense probably benign
R4851:Olfr411 UTSW 11 74346943 missense probably benign
R4990:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R4992:Olfr411 UTSW 11 74347197 missense probably damaging 1.00
R5130:Olfr411 UTSW 11 74347167 missense probably damaging 1.00
R5171:Olfr411 UTSW 11 74346814 missense probably benign 0.08
R5240:Olfr411 UTSW 11 74347242 missense probably damaging 1.00
R5346:Olfr411 UTSW 11 74346670 missense probably benign 0.00
R5723:Olfr411 UTSW 11 74347128 missense possibly damaging 0.66
R6581:Olfr411 UTSW 11 74347206 missense probably damaging 0.98
R7561:Olfr411 UTSW 11 74347610 intron probably benign
Z1177:Olfr411 UTSW 11 74347480 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACATCAGGGTTCCTAAGGC -3'
(R):5'- CACACTTAACTTCTGCGGCC -3'

Sequencing Primer
(F):5'- CACATCAGGGTTCCTAAGGCTGTAG -3'
(R):5'- GCGGCCCCAATGTGATCAATC -3'
Posted On2016-10-05