Incidental Mutation 'R5465:Rtn4r'
ID433221
Institutional Source Beutler Lab
Gene Symbol Rtn4r
Ensembl Gene ENSMUSG00000043811
Gene Namereticulon 4 receptor
SynonymsNgR, Nogo-66 receptor, NgR1
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18127642-18152408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18151427 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 240 (M240L)
Ref Sequence ENSEMBL: ENSMUSP00000062924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059589]
Predicted Effect probably benign
Transcript: ENSMUST00000059589
AA Change: M240L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062924
Gene: ENSMUSG00000043811
AA Change: M240L

DomainStartEndE-ValueType
LRRNT 26 61 2.32e0 SMART
LRR 60 79 8.49e1 SMART
LRR 80 103 8.01e0 SMART
LRR 104 128 1.22e1 SMART
LRR_TYP 129 152 4.11e-2 SMART
LRR_TYP 153 176 8.6e-5 SMART
LRR_TYP 177 200 5.67e-5 SMART
LRR 201 224 6.13e-1 SMART
LRR 225 248 6.4e0 SMART
LRRCT 260 310 1.65e-2 SMART
low complexity region 405 418 N/A INTRINSIC
low complexity region 446 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for reticulon 4, oligodendrocyte myelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased exploration in new environment, impaired coordination, and improved recovery and rubrospinal axon regeneration following spinal cord injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Ralgapb C A 2: 158,448,405 T412N possibly damaging Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Rtn4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rtn4r APN 16 18151396 missense possibly damaging 0.68
IGL01647:Rtn4r APN 16 18151326 missense probably damaging 0.99
IGL01999:Rtn4r APN 16 18151457 missense possibly damaging 0.88
IGL02738:Rtn4r APN 16 18151188 missense probably damaging 1.00
R2064:Rtn4r UTSW 16 18151257 missense probably damaging 1.00
R4709:Rtn4r UTSW 16 18151182 missense probably damaging 1.00
R6155:Rtn4r UTSW 16 18151394 missense probably benign 0.02
R6267:Rtn4r UTSW 16 18151182 missense probably damaging 1.00
R6703:Rtn4r UTSW 16 18151191 missense probably damaging 0.99
R7769:Rtn4r UTSW 16 18151289 missense probably benign 0.12
R7816:Rtn4r UTSW 16 18151535 missense probably benign 0.00
R7904:Rtn4r UTSW 16 18151485 missense probably benign 0.00
R8240:Rtn4r UTSW 16 18151394 missense probably benign 0.02
Z1177:Rtn4r UTSW 16 18151820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCATGGCAACCGTATC -3'
(R):5'- TCAGTGAGCTGACTGGTCTG -3'

Sequencing Primer
(F):5'- ATGGCAACCGTATCCCCAGTG -3'
(R):5'- AGGCGCTTAAGATCACGGTCTG -3'
Posted On2016-10-06