Incidental Mutation 'R5679:Aldh3a1'
ID442939
Institutional Source Beutler Lab
Gene Symbol Aldh3a1
Ensembl Gene ENSMUSG00000019102
Gene Namealdehyde dehydrogenase family 3, subfamily A1
SynonymsAhd4, Ahd-4, Aldh3, Aldh
MMRRC Submission 043176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5679 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61207537-61218421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61217168 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 346 (R346Q)
Ref Sequence ENSEMBL: ENSMUSP00000104356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019246] [ENSMUST00000108716] [ENSMUST00000147792]
Predicted Effect probably benign
Transcript: ENSMUST00000019246
AA Change: R346Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019246
Gene: ENSMUSG00000019102
AA Change: R346Q

DomainStartEndE-ValueType
Pfam:Aldedh 1 428 3.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108716
AA Change: R346Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104356
Gene: ENSMUSG00000019102
AA Change: R346Q

DomainStartEndE-ValueType
Pfam:Aldedh 1 428 4.1e-98 PFAM
Pfam:LuxC 4 389 9.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147792
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcat1 A T 6: 145,007,748 F304L probably damaging Het
Ccdc178 T G 18: 22,067,429 K439N probably benign Het
Cdkn2a T C 4: 89,276,861 D84G possibly damaging Het
Chst8 T A 7: 34,675,304 H370L probably damaging Het
Dimt1 A G 13: 106,947,600 T32A possibly damaging Het
Dph6 T C 2: 114,567,941 I162V probably benign Het
E230025N22Rik C T 18: 36,685,382 G465R possibly damaging Het
Fbxw7 T A 3: 84,977,487 N612K probably damaging Het
Gpr179 A G 11: 97,336,745 V1528A probably benign Het
Gucy2g T A 19: 55,231,079 K370N possibly damaging Het
Ipo13 A T 4: 117,894,832 W903R probably damaging Het
Itgax T A 7: 128,134,990 H311Q probably benign Het
Kmt2d T C 15: 98,854,272 probably benign Het
Lox T C 18: 52,528,917 N138S probably benign Het
Mre11a T A 9: 14,786,919 I21N probably damaging Het
Ncan T G 8: 70,112,626 Y217S probably damaging Het
Nfil3 A G 13: 52,968,491 F126L possibly damaging Het
Nfu1 T C 6: 87,019,397 V110A probably damaging Het
Oit1 T C 14: 8,349,305 E215G probably damaging Het
Olfr1009 A T 2: 85,722,046 I214F probably damaging Het
Olfr1120 T C 2: 87,357,545 F34L possibly damaging Het
Olfr513 A G 7: 108,754,996 I47V probably damaging Het
Palld T C 8: 61,684,945 Q592R possibly damaging Het
Pcdhac1 T A 18: 37,092,477 L781Q probably damaging Het
Rcl1 A G 19: 29,121,258 probably null Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Scrt1 T A 15: 76,519,062 T243S unknown Het
Slc22a30 G T 19: 8,335,771 T550K possibly damaging Het
Strc A G 2: 121,368,100 S1437P probably benign Het
Tecpr1 T A 5: 144,207,423 I654F possibly damaging Het
Tfcp2l1 A G 1: 118,668,647 M371V probably benign Het
Vmn2r11 T C 5: 109,054,842 N123S probably benign Het
Wdr81 T C 11: 75,452,923 D506G probably damaging Het
Xylt1 A G 7: 117,643,650 D640G probably damaging Het
Zfp148 T G 16: 33,495,786 M276R probably damaging Het
Zfp329 G A 7: 12,810,031 T522I probably damaging Het
Other mutations in Aldh3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3a1 APN 11 61213596 missense probably damaging 1.00
IGL00833:Aldh3a1 APN 11 61217180 missense probably damaging 0.99
IGL02281:Aldh3a1 APN 11 61217123 unclassified probably null
IGL02608:Aldh3a1 APN 11 61216321 missense probably damaging 1.00
IGL03294:Aldh3a1 APN 11 61214722 missense probably damaging 1.00
R0006:Aldh3a1 UTSW 11 61217101 missense probably damaging 1.00
R0453:Aldh3a1 UTSW 11 61215512 missense probably benign 0.01
R0612:Aldh3a1 UTSW 11 61214619 missense probably damaging 1.00
R0637:Aldh3a1 UTSW 11 61215478 unclassified probably benign
R1613:Aldh3a1 UTSW 11 61214551 missense probably damaging 0.98
R3423:Aldh3a1 UTSW 11 61215536 missense probably damaging 1.00
R3772:Aldh3a1 UTSW 11 61214605 missense possibly damaging 0.86
R4673:Aldh3a1 UTSW 11 61213494 missense probably benign
R4997:Aldh3a1 UTSW 11 61212311 missense probably benign 0.02
R5425:Aldh3a1 UTSW 11 61213581 missense probably benign 0.01
R5514:Aldh3a1 UTSW 11 61218041 missense probably damaging 1.00
R6150:Aldh3a1 UTSW 11 61213508 missense probably benign
R6662:Aldh3a1 UTSW 11 61214655 missense probably benign 0.01
R6986:Aldh3a1 UTSW 11 61214251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGATGTTGGCACTGGCTG -3'
(R):5'- TGGCCATTTCATCCACAGG -3'

Sequencing Primer
(F):5'- CACTGGCTGTGTGTATATGTATG -3'
(R):5'- TTGGTGCAAGGTCACACAC -3'
Posted On2016-11-09