Mutagenetix > Incidental Mutation

Incidental Mutation 'R5683:Lrriq1'

443193

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R5683 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103173375 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1082 (L1082F)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000166240
AA Change: L1082F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: L1082F

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	C	11: 72,202,440	M22R	probably benign	Het
Acad11	A	G	9: 104,084,283	E397G	probably damaging	Het
Actrt3	A	T	3: 30,598,278	D222E	probably benign	Het
Akap11	A	T	14: 78,512,578	S790T	probably damaging	Het
Arhgap5	T	A	12: 52,519,586	D1113E	probably benign	Het
Arl2	C	A	19: 6,134,764	R153L	probably benign	Het
B3glct	T	A	5: 149,696,437	M19K	probably benign	Het
Ccdc138	C	A	10: 58,540,819	Q425K	probably damaging	Het
Ccdc178	T	A	18: 22,130,122	K143N	probably benign	Het
Cd200r4	T	A	16: 44,832,948	I73K	probably benign	Het
Chaf1b	A	G	16: 93,887,142	K94E	possibly damaging	Het
Cmtm2a	T	C	8: 104,293,044		probably null	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Fnbp4	C	A	2: 90,752,862	N277K	probably damaging	Het
Htr7	C	A	19: 35,969,871	A248S	probably damaging	Het
Itsn1	T	C	16: 91,905,380	Y37H	probably benign	Het
Kdm8	A	G	7: 125,455,173	Y16C	possibly damaging	Het
Kif1b	A	T	4: 149,222,261	Y881N	probably damaging	Het
Lhcgr	C	T	17: 88,772,019	V80I	probably benign	Het
Met	A	G	6: 17,571,744	Y1354C	probably damaging	Het
Nbea	A	G	3: 55,628,586	L2859P	possibly damaging	Het
Ndufaf5	T	A	2: 140,202,923	M279K	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,272	I872T	probably damaging	Het
Npnt	A	T	3: 132,906,840		probably null	Het
Nsd1	G	A	13: 55,246,148	V521I	probably benign	Het
Olfr138	G	A	17: 38,275,546	M258I	possibly damaging	Het
Pak6	T	A	2: 118,693,912	Y469N	probably damaging	Het
Parp4	C	T	14: 56,647,429	R1322*	probably null	Het
Pax6	T	C	2: 105,685,907	Y177H	probably benign	Het
Pcdhb4	A	T	18: 37,308,989	T451S	probably benign	Het
Pcdhgb5	A	T	18: 37,731,854	D234V	probably damaging	Het
Pramef6	A	G	4: 143,895,853	S311P	probably damaging	Het
Ralb	G	A	1: 119,475,956	A147V	possibly damaging	Het
Rgs11	A	G	17: 26,205,181	K196E	probably benign	Het
Rnft1	A	T	11: 86,491,790	T280S	probably benign	Het
Slco4c1	G	T	1: 96,867,834	H166Q	probably damaging	Het
Sycp3	T	C	10: 88,472,935	S248P	probably damaging	Het
Tab2	A	G	10: 7,919,112		probably null	Het
Tgm6	T	C	2: 130,138,955	M224T	probably damaging	Het
Topbp1	A	T	9: 103,312,804	E193V	possibly damaging	Het
Trim36	T	C	18: 46,169,292	Y551C	probably damaging	Het
Ttc17	T	C	2: 94,362,521	Y628C	probably damaging	Het
Vmn1r180	A	C	7: 23,953,210	D266A	possibly damaging	Het
Vmn2r104	T	A	17: 20,040,719	K481*	probably null	Het
Zc3hav1	A	G	6: 38,307,237	V981A	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAACCTTACCTCTTCTGTGTG -3'
(R):5'- TTTGGCCCAAGTTTCTAACATTGG -3'

Sequencing Primer
(F):5'- AACCTTACCTCTTCTGTGTGATATAC -3'
(R):5'- GGCCCAAGTTTCTAACATTGGTTCTC -3'

Posted On

2016-11-09