Incidental Mutation 'R5769:Ushbp1'
ID446442
Institutional Source Beutler Lab
Gene Symbol Ushbp1
Ensembl Gene ENSMUSG00000034911
Gene NameUSH1 protein network component harmonin binding protein 1
SynonymsMCC2, 2210404N08Rik
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5769 (G1)
Quality Score224
Status Validated
Chromosome8
Chromosomal Location71384272-71395802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71386219 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 570 (N570K)
Ref Sequence ENSEMBL: ENSMUSP00000045668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002466] [ENSMUST00000049184] [ENSMUST00000212626]
Predicted Effect probably benign
Transcript: ENSMUST00000002466
SMART Domains Protein: ENSMUSP00000002466
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
ZnF_C4 54 125 1.48e-38 SMART
low complexity region 173 185 N/A INTRINSIC
HOLI 191 351 1.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049184
AA Change: N570K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045668
Gene: ENSMUSG00000034911
AA Change: N570K

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
coiled coil region 179 218 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 288 352 1.3e-29 PFAM
Blast:HOLI 467 623 2e-24 BLAST
coiled coil region 628 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212516
Predicted Effect probably benign
Transcript: ENSMUST00000212626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213000
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Ushbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ushbp1 APN 8 71387432 missense probably benign
IGL02511:Ushbp1 APN 8 71390937 missense probably null 0.00
IGL02586:Ushbp1 APN 8 71388750 splice site probably benign
IGL02929:Ushbp1 APN 8 71394476 missense probably damaging 0.99
IGL03127:Ushbp1 APN 8 71394376 missense possibly damaging 0.65
R0012:Ushbp1 UTSW 8 71395040 unclassified probably benign
R0012:Ushbp1 UTSW 8 71395040 unclassified probably benign
R0091:Ushbp1 UTSW 8 71388970 missense possibly damaging 0.65
R0097:Ushbp1 UTSW 8 71390713 missense probably damaging 0.98
R0097:Ushbp1 UTSW 8 71390713 missense probably damaging 0.98
R0242:Ushbp1 UTSW 8 71390118 nonsense probably null
R0242:Ushbp1 UTSW 8 71390118 nonsense probably null
R0276:Ushbp1 UTSW 8 71394649 missense possibly damaging 0.83
R0308:Ushbp1 UTSW 8 71391053 missense probably damaging 0.99
R0471:Ushbp1 UTSW 8 71394377 nonsense probably null
R0726:Ushbp1 UTSW 8 71388747 splice site probably benign
R0894:Ushbp1 UTSW 8 71390224 intron probably null
R1451:Ushbp1 UTSW 8 71386019 missense possibly damaging 0.53
R1797:Ushbp1 UTSW 8 71388923 missense probably damaging 0.99
R2393:Ushbp1 UTSW 8 71394488 missense probably benign 0.05
R2905:Ushbp1 UTSW 8 71387535 nonsense probably null
R4567:Ushbp1 UTSW 8 71385717 missense probably damaging 0.99
R4717:Ushbp1 UTSW 8 71385669 missense probably damaging 0.99
R4977:Ushbp1 UTSW 8 71395049 critical splice donor site probably null
R5151:Ushbp1 UTSW 8 71395155 missense possibly damaging 0.85
R5584:Ushbp1 UTSW 8 71390979 missense possibly damaging 0.77
R5760:Ushbp1 UTSW 8 71387368 missense probably damaging 0.96
R6186:Ushbp1 UTSW 8 71391003 missense possibly damaging 0.91
R6661:Ushbp1 UTSW 8 71390661 missense unknown
R7172:Ushbp1 UTSW 8 71388766 missense possibly damaging 0.85
R7252:Ushbp1 UTSW 8 71394602 missense probably benign
R7352:Ushbp1 UTSW 8 71388881 missense possibly damaging 0.46
R7650:Ushbp1 UTSW 8 71390924 missense possibly damaging 0.77
R7891:Ushbp1 UTSW 8 71388778 missense possibly damaging 0.86
R7974:Ushbp1 UTSW 8 71388778 missense possibly damaging 0.86
Z1176:Ushbp1 UTSW 8 71390689 missense probably benign
Z1177:Ushbp1 UTSW 8 71394581 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGAGTCACCTGTTCCAGCTG -3'
(R):5'- GGCGAAGACCCCATTTCTTATG -3'

Sequencing Primer
(F):5'- TGTTCCAGCTGCTGCCG -3'
(R):5'- CAGGCAGATCTCTGAATTTGAGCC -3'
Posted On2016-11-21