Incidental Mutation 'R5769:Tmtc2'
ID446449
Institutional Source Beutler Lab
Gene Symbol Tmtc2
Ensembl Gene ENSMUSG00000036019
Gene Nametransmembrane and tetratricopeptide repeat containing 2
SynonymsD330034A10Rik, 8430438D04Rik
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location105187663-105574451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105370046 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 463 (I463V)
Ref Sequence ENSEMBL: ENSMUSP00000061919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061506]
Predicted Effect probably benign
Transcript: ENSMUST00000061506
AA Change: I463V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000061919
Gene: ENSMUSG00000036019
AA Change: I463V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Pfam:DUF1736 247 321 7.3e-33 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 425 444 N/A INTRINSIC
TPR 493 526 1.6e-3 SMART
TPR 527 560 6.84e-3 SMART
TPR 561 594 2.52e-1 SMART
TPR 606 639 3.12e-6 SMART
TPR 643 676 3.99e1 SMART
TPR 677 710 7.12e-1 SMART
low complexity region 729 739 N/A INTRINSIC
TPR 745 778 1.51e1 SMART
TPR 779 812 1.43e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143691
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein localized to the endoplasmic reticulum (ER). The encoded protein contains many tetratricopeptide repeats, sequences known for being involved in protein-protein interactions. This protein binds both the calcium uptake pump SERCA2B and the carbohydrate-binding chaperone calnexin, and it appears to play a role in calcium homeostasis in the ER. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Tmtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tmtc2 APN 10 105321446 missense possibly damaging 0.82
IGL01284:Tmtc2 APN 10 105271511 missense possibly damaging 0.56
IGL01317:Tmtc2 APN 10 105413785 missense probably damaging 1.00
IGL01327:Tmtc2 APN 10 105348479 missense probably benign 0.15
IGL01637:Tmtc2 APN 10 105370085 missense probably benign 0.00
IGL02176:Tmtc2 APN 10 105348493 missense probably benign 0.00
IGL02354:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02361:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02514:Tmtc2 APN 10 105190099 missense possibly damaging 0.94
IGL02540:Tmtc2 APN 10 105413339 missense probably benign 0.45
IGL02625:Tmtc2 APN 10 105370546 missense probably damaging 1.00
IGL02938:Tmtc2 APN 10 105413296 missense probably damaging 1.00
IGL02939:Tmtc2 APN 10 105370550 missense probably damaging 1.00
IGL03388:Tmtc2 APN 10 105321483 splice site probably benign
PIT4402001:Tmtc2 UTSW 10 105413407 missense probably damaging 1.00
PIT4449001:Tmtc2 UTSW 10 105303604 missense probably damaging 1.00
R1424:Tmtc2 UTSW 10 105413368 missense probably benign 0.00
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1529:Tmtc2 UTSW 10 105303658 missense probably damaging 1.00
R1903:Tmtc2 UTSW 10 105190108 missense probably benign 0.00
R2225:Tmtc2 UTSW 10 105370357 missense probably benign 0.22
R4280:Tmtc2 UTSW 10 105348433 critical splice donor site probably null
R4602:Tmtc2 UTSW 10 105413530 missense probably benign
R4603:Tmtc2 UTSW 10 105413530 missense probably benign
R4624:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4625:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4628:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4629:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R5192:Tmtc2 UTSW 10 105190177 missense probably damaging 1.00
R5846:Tmtc2 UTSW 10 105271441 intron probably benign
R5892:Tmtc2 UTSW 10 105413505 missense probably benign 0.08
R5897:Tmtc2 UTSW 10 105413598 missense probably damaging 1.00
R6362:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R6391:Tmtc2 UTSW 10 105573690 missense probably benign 0.06
R6640:Tmtc2 UTSW 10 105573749 start codon destroyed probably benign 0.01
R6812:Tmtc2 UTSW 10 105413269 missense probably benign 0.01
R6975:Tmtc2 UTSW 10 105323002 missense probably benign 0.01
R7042:Tmtc2 UTSW 10 105370616 missense probably damaging 1.00
R7063:Tmtc2 UTSW 10 105348525 missense probably damaging 1.00
R7211:Tmtc2 UTSW 10 105573726 missense probably benign 0.31
R7288:Tmtc2 UTSW 10 105413608 missense probably damaging 1.00
R7576:Tmtc2 UTSW 10 105370621 missense probably damaging 1.00
R7728:Tmtc2 UTSW 10 105271497 critical splice donor site probably null
R7850:Tmtc2 UTSW 10 105573707 missense probably benign 0.01
R7933:Tmtc2 UTSW 10 105573707 missense probably benign 0.01
R8024:Tmtc2 UTSW 10 105190126 missense probably benign 0.37
Z1176:Tmtc2 UTSW 10 105303622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTAAGGCACCAAACGATGC -3'
(R):5'- CGTCCACGGAGAACATTGTTATTC -3'

Sequencing Primer
(F):5'- ATGCTCTAAGAAGGCTGCC -3'
(R):5'- CACGGAGAACATTGTTATTCTGTCC -3'
Posted On2016-11-21