Incidental Mutation 'R5710:Sclt1'
List |< first << previous [record 31 of 41] next >> last >|
ID452158
Institutional Source Beutler Lab
Gene Symbol Sclt1
Ensembl Gene ENSMUSG00000059834
Gene Namesodium channel and clathrin linker 1
Synonyms2610207F23Rik, 4931421F20Rik
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location41626720-41742514 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 41663963 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 14 (E14*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]
Predicted Effect probably null
Transcript: ENSMUST00000026866
AA Change: E428*
SMART Domains Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834
AA Change: E428*

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
internal_repeat_1 166 179 6.29e-5 PROSPERO
coiled coil region 372 543 N/A INTRINSIC
internal_repeat_1 555 568 6.29e-5 PROSPERO
coiled coil region 571 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140373
Predicted Effect probably benign
Transcript: ENSMUST00000146125
Predicted Effect probably benign
Transcript: ENSMUST00000148769
SMART Domains Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
coiled coil region 178 333 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154773
AA Change: E14*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Sclt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sclt1 APN 3 41741991 unclassified probably benign
IGL01106:Sclt1 APN 3 41675319 splice site probably benign
IGL01368:Sclt1 APN 3 41711175 missense probably damaging 0.96
IGL02001:Sclt1 APN 3 41681721 missense possibly damaging 0.63
IGL02897:Sclt1 APN 3 41675387 missense probably benign 0.01
IGL03066:Sclt1 APN 3 41717843 missense probably benign 0.00
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0172:Sclt1 UTSW 3 41717787 missense possibly damaging 0.84
R0359:Sclt1 UTSW 3 41661570 critical splice donor site probably null
R1281:Sclt1 UTSW 3 41647620 missense probably benign 0.01
R1831:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1832:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1833:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R2027:Sclt1 UTSW 3 41730888 missense probably benign 0.00
R4578:Sclt1 UTSW 3 41671465 nonsense probably null
R5502:Sclt1 UTSW 3 41657275 missense probably benign 0.28
R5558:Sclt1 UTSW 3 41661590 missense probably benign 0.14
R5601:Sclt1 UTSW 3 41730919 missense probably benign
R6041:Sclt1 UTSW 3 41627177 missense probably damaging 0.99
R6274:Sclt1 UTSW 3 41629516 critical splice donor site probably null
R6765:Sclt1 UTSW 3 41730902 missense unknown
R7171:Sclt1 UTSW 3 41717760 missense probably benign 0.00
R7489:Sclt1 UTSW 3 41629597 missense probably damaging 0.99
R8040:Sclt1 UTSW 3 41657376 missense probably damaging 1.00
R8158:Sclt1 UTSW 3 41671482 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CACTTTTGGGCTGAGTGTAGAATAG -3'
(R):5'- CAATTATGGTGGCCTTACTTAGC -3'

Sequencing Primer
(F):5'- TGGGCTGAGTGTAGAATAGTAAATAG -3'
(R):5'- GGCCTTACTTAGCTTTGTTAGATAAC -3'
Posted On2017-01-03