Incidental Mutation 'R5722:Sv2a'
ID452255
Institutional Source Beutler Lab
Gene Symbol Sv2a
Ensembl Gene ENSMUSG00000038486
Gene Namesynaptic vesicle glycoprotein 2 a
Synonyms
MMRRC Submission 043340-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96181151-96195521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96185023 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 13 (R13H)
Ref Sequence ENSEMBL: ENSMUSP00000037576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035371]
Predicted Effect probably benign
Transcript: ENSMUST00000035371
AA Change: R13H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037576
Gene: ENSMUSG00000038486
AA Change: R13H

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
Pfam:Sugar_tr 149 484 5.3e-30 PFAM
Pfam:MFS_1 168 483 1.6e-24 PFAM
Pfam:Pentapeptide_4 513 585 7.7e-11 PFAM
Pfam:MFS_1 561 739 3.9e-12 PFAM
Pfam:Sugar_tr 588 742 4.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133665
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three related synaptic vesicle proteins. The encoded protein may interact with synaptotagmin to enhance low frequency neurotransmission in quiescent neurons. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit seizures, retarded growth, and reduced hippocampal (GABA)ergic neurotransmission. Many mutants die shortly after birth, and all are dead by three weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Cntnap5c A T 17: 58,313,857 H977L probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Sv2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Sv2a APN 3 96193284 missense probably benign 0.00
IGL01081:Sv2a APN 3 96189696 missense probably benign 0.35
IGL01786:Sv2a APN 3 96188209 missense probably benign 0.08
IGL02220:Sv2a APN 3 96190716 missense probably benign 0.13
IGL02701:Sv2a APN 3 96187131 missense probably damaging 0.99
IGL02740:Sv2a APN 3 96185407 missense possibly damaging 0.92
IGL03067:Sv2a APN 3 96185182 missense probably damaging 1.00
R0760:Sv2a UTSW 3 96188182 missense probably damaging 1.00
R2070:Sv2a UTSW 3 96193875 missense possibly damaging 0.95
R2071:Sv2a UTSW 3 96193875 missense possibly damaging 0.95
R2902:Sv2a UTSW 3 96193756 missense possibly damaging 0.84
R3014:Sv2a UTSW 3 96189435 nonsense probably null
R3153:Sv2a UTSW 3 96185258 missense possibly damaging 0.75
R4472:Sv2a UTSW 3 96192494 missense probably benign 0.36
R4653:Sv2a UTSW 3 96190762 critical splice donor site probably null
R4791:Sv2a UTSW 3 96192558 missense possibly damaging 0.68
R4844:Sv2a UTSW 3 96188379 missense probably damaging 1.00
R4919:Sv2a UTSW 3 96190755 missense probably benign 0.44
R5230:Sv2a UTSW 3 96185460 missense probably damaging 1.00
R5305:Sv2a UTSW 3 96185458 missense possibly damaging 0.83
R5656:Sv2a UTSW 3 96185572 missense probably damaging 1.00
R5659:Sv2a UTSW 3 96190303 missense possibly damaging 0.96
R6299:Sv2a UTSW 3 96188249 critical splice donor site probably null
R6315:Sv2a UTSW 3 96188186 missense probably benign 0.06
R7192:Sv2a UTSW 3 96193746 missense probably damaging 1.00
R7374:Sv2a UTSW 3 96188209 missense probably benign 0.08
R7691:Sv2a UTSW 3 96188411 missense probably benign 0.00
X0026:Sv2a UTSW 3 96189452 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTCAGTCTGAGCCCAAAG -3'
(R):5'- GGGATGCCCTGATATTCTCC -3'

Sequencing Primer
(F):5'- CTCAGTCTGAGCCCAAAGATATTGG -3'
(R):5'- TCGGTGGCATCACTAGAAGC -3'
Posted On2017-01-03