Incidental Mutation 'R5862:Shkbp1'
ID453963
Institutional Source Beutler Lab
Gene Symbol Shkbp1
Ensembl Gene ENSMUSG00000089832
Gene NameSh3kbp1 binding protein 1
SynonymsB930062H15Rik, SB1
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27342133-27356019 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 27343404 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 536 (S536*)
Ref Sequence ENSEMBL: ENSMUSP00000003857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003857]
Predicted Effect probably null
Transcript: ENSMUST00000003857
AA Change: S536*
SMART Domains Protein: ENSMUSP00000003857
Gene: ENSMUSG00000089832
AA Change: S536*

DomainStartEndE-ValueType
BTB 19 119 1.65e-16 SMART
low complexity region 183 194 N/A INTRINSIC
Blast:WD40 196 271 1e-21 BLAST
WD40 277 313 1.9e2 SMART
WD40 419 457 3.45e-1 SMART
WD40 527 577 3.68e1 SMART
low complexity region 612 631 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152053
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Shkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Shkbp1 APN 7 27355251 missense probably benign 0.28
IGL01469:Shkbp1 APN 7 27355941 missense probably benign
IGL01787:Shkbp1 APN 7 27342450 missense possibly damaging 0.93
IGL02149:Shkbp1 APN 7 27342639 unclassified probably benign
IGL02902:Shkbp1 APN 7 27342716 missense probably damaging 0.97
R0086:Shkbp1 UTSW 7 27352026 missense probably benign 0.00
R0219:Shkbp1 UTSW 7 27352061 missense probably benign 0.01
R0485:Shkbp1 UTSW 7 27348581 missense probably damaging 1.00
R1036:Shkbp1 UTSW 7 27345296 missense possibly damaging 0.86
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1608:Shkbp1 UTSW 7 27354779 missense probably benign 0.01
R1757:Shkbp1 UTSW 7 27342351 missense probably benign
R1968:Shkbp1 UTSW 7 27355400 critical splice donor site probably null
R2763:Shkbp1 UTSW 7 27347029 missense probably benign 0.05
R3027:Shkbp1 UTSW 7 27343393 missense probably benign 0.18
R3924:Shkbp1 UTSW 7 27342402 missense probably benign
R4425:Shkbp1 UTSW 7 27343302 missense probably benign 0.38
R5048:Shkbp1 UTSW 7 27352096 unclassified probably benign
R5955:Shkbp1 UTSW 7 27342524 missense probably benign
R6016:Shkbp1 UTSW 7 27354401 missense possibly damaging 0.92
R6226:Shkbp1 UTSW 7 27351980 missense probably null 1.00
R6362:Shkbp1 UTSW 7 27351695 critical splice donor site probably null
R6382:Shkbp1 UTSW 7 27352059 nonsense probably null
R6460:Shkbp1 UTSW 7 27350538 missense probably benign 0.01
R6647:Shkbp1 UTSW 7 27342375 missense probably benign
R7025:Shkbp1 UTSW 7 27355281 missense possibly damaging 0.47
R7255:Shkbp1 UTSW 7 27342748 missense possibly damaging 0.93
R7522:Shkbp1 UTSW 7 27347158 missense possibly damaging 0.88
R7571:Shkbp1 UTSW 7 27347131 missense possibly damaging 0.90
R8207:Shkbp1 UTSW 7 27352684 missense probably benign 0.01
Z1177:Shkbp1 UTSW 7 27347001 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCAGGGAATACCAGGAGTTT -3'
(R):5'- CTGGATGGGGATGGATACGG -3'

Sequencing Primer
(F):5'- ATACCAGGAGTTTGGCCCAG -3'
(R):5'- TGGATAAGGAGTGGTGGATAATG -3'
Posted On2017-02-10