Incidental Mutation 'R5862:Olfr1036'
ID453954
Institutional Source Beutler Lab
Gene Symbol Olfr1036
Ensembl Gene ENSMUSG00000099820
Gene Nameolfactory receptor 1036
SynonymsGA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86073992-86077194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86075646 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 302 (I302T)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
Predicted Effect probably benign
Transcript: ENSMUST00000164985
AA Change: I302T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: I302T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Olfr1036
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr1036 APN 2 86075472 missense possibly damaging 0.90
IGL02370:Olfr1036 APN 2 86074788 missense probably damaging 0.98
R0269:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0409:Olfr1036 UTSW 2 86075302 nonsense probably null
R0412:Olfr1036 UTSW 2 86075091 missense probably benign 0.16
R0617:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0846:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R1251:Olfr1036 UTSW 2 86074820 missense probably benign 0.20
R1646:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
R1670:Olfr1036 UTSW 2 86075250 missense probably benign
R1775:Olfr1036 UTSW 2 86074760 missense possibly damaging 0.88
R1968:Olfr1036 UTSW 2 86075205 missense probably damaging 1.00
R2877:Olfr1036 UTSW 2 86075331 missense possibly damaging 0.82
R4639:Olfr1036 UTSW 2 86075579 missense probably benign 0.24
R4957:Olfr1036 UTSW 2 86075510 missense probably damaging 1.00
R5267:Olfr1036 UTSW 2 86075538 missense probably benign 0.28
R6235:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R6355:Olfr1036 UTSW 2 86074872 missense probably benign 0.04
R6943:Olfr1036 UTSW 2 86074920 missense probably damaging 1.00
R8033:Olfr1036 UTSW 2 86074875 missense possibly damaging 0.61
R8796:Olfr1036 UTSW 2 86075174 missense possibly damaging 0.94
R8861:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
Z1088:Olfr1036 UTSW 2 86075323 missense possibly damaging 0.66
Z1177:Olfr1036 UTSW 2 86075424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTACGCATGCACTCGGC -3'
(R):5'- CACATGCTTAATAAAGAGCAATCATGC -3'

Sequencing Primer
(F):5'- AGAAAGGCATTCTCCACCTGTGG -3'
(R):5'- GCTGTAAAGCATCACTGTGG -3'
Posted On2017-02-10