Incidental Mutation 'R5855:Igll1'
ID454884
Institutional Source Beutler Lab
Gene Symbol Igll1
Ensembl Gene ENSMUSG00000075370
Gene Nameimmunoglobulin lambda-like polypeptide 1
SynonymsIgll, Igl-5, Lambda 5
MMRRC Submission 043229-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5855 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16860671-16863985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16861057 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 130 (V130M)
Ref Sequence ENSEMBL: ENSMUSP00000097713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100136] [ENSMUST00000124890]
Predicted Effect probably damaging
Transcript: ENSMUST00000100136
AA Change: V130M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097713
Gene: ENSMUSG00000075370
AA Change: V130M

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc1 126 200 2.17e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124649
Predicted Effect probably damaging
Transcript: ENSMUST00000124890
AA Change: V106M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122045
Gene: ENSMUSG00000075370
AA Change: V106M

DomainStartEndE-ValueType
IGc1 102 176 2.17e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231439
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, a leaky blockade of B cell development at the pre-B stage, and decreased IgG levels in response to a T-cell dependent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T G 7: 131,424,599 L57R probably damaging Het
Bmpr1b G A 3: 141,871,385 T55M possibly damaging Het
Cep350 G A 1: 155,953,762 T132I probably benign Het
Cops4 A T 5: 100,547,414 M400L probably benign Het
Cul1 G A 6: 47,523,213 D653N probably benign Het
Cyp3a13 C G 5: 137,919,056 L36F probably damaging Het
Dcaf10 T C 4: 45,342,558 F131L probably benign Het
Dgkh T C 14: 78,624,504 probably null Het
Kif2c C T 4: 117,182,542 probably benign Het
Klra7 T C 6: 130,218,958 D262G possibly damaging Het
Lrrc27 T C 7: 139,218,335 probably benign Het
Maf A G 8: 115,705,792 S358P probably benign Het
Map1a A G 2: 121,303,674 D1419G possibly damaging Het
Map3k1 G A 13: 111,755,979 A914V probably benign Het
Naa25 T G 5: 121,423,692 L436R possibly damaging Het
Ndc1 T C 4: 107,383,707 I294T probably damaging Het
Nek1 A C 8: 61,016,272 D121A probably damaging Het
Nfil3 C T 13: 52,968,710 G53R probably benign Het
Olfr63 T C 17: 33,269,336 V204A possibly damaging Het
Parp14 A T 16: 35,840,927 Y1550* probably null Het
Patl1 A G 19: 11,921,516 I192V probably damaging Het
Pax3 G A 1: 78,121,651 T367I probably damaging Het
Pla2g4a C T 1: 149,880,063 V208M probably damaging Het
Prdm10 A T 9: 31,337,323 K347M probably damaging Het
Prkd1 A T 12: 50,392,916 M376K probably benign Het
Prkg1 C T 19: 30,894,694 V219I possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox4 T C 13: 28,952,996 E9G probably damaging Het
Spon1 T A 7: 114,029,072 D354E probably damaging Het
Stat2 T A 10: 128,283,494 L450H probably damaging Het
Tek T A 4: 94,853,553 M849K probably damaging Het
Tmem63c G A 12: 87,075,726 D433N probably damaging Het
Tnpo3 G A 6: 29,589,033 T106I probably damaging Het
Tns1 G T 1: 73,918,033 A1674D possibly damaging Het
Trim8 T C 19: 46,515,410 V467A possibly damaging Het
Trmo T A 4: 46,382,568 H183L probably benign Het
Trpm1 C A 7: 64,268,962 C683* probably null Het
Vsig10 T G 5: 117,338,270 L263R probably damaging Het
Zfp874a A T 13: 67,442,693 Y291N probably benign Het
Other mutations in Igll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Igll1 APN 16 16860919 missense probably benign 0.04
IGL03060:Igll1 APN 16 16862427 critical splice donor site probably null
PIT4445001:Igll1 UTSW 16 16860919 missense probably benign 0.04
R0058:Igll1 UTSW 16 16863876 missense probably benign 0.02
R0058:Igll1 UTSW 16 16863876 missense probably benign 0.02
R2014:Igll1 UTSW 16 16863775 missense probably benign
R2015:Igll1 UTSW 16 16863775 missense probably benign
R4242:Igll1 UTSW 16 16863700 missense probably benign 0.15
R5024:Igll1 UTSW 16 16863793 missense probably benign 0.05
R5453:Igll1 UTSW 16 16863694 unclassified probably null
R6000:Igll1 UTSW 16 16863941 start gained probably benign
R6946:Igll1 UTSW 16 16861056 missense probably damaging 1.00
R7256:Igll1 UTSW 16 16861093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTCATGAGTGACCCGG -3'
(R):5'- ATCCCTGGATGGAAGACTGATG -3'

Sequencing Primer
(F):5'- CAGCTGTATCTACTGTGAGGCATC -3'
(R):5'- ATGCTGTAGTGAATGGCCAC -3'
Posted On2017-02-10