Incidental Mutation 'R5855:Kif2c'
ID454858
Institutional Source Beutler Lab
Gene Symbol Kif2c
Ensembl Gene ENSMUSG00000028678
Gene Namekinesin family member 2C
Synonyms4930402F02Rik
MMRRC Submission 043229-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5855 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117159639-117182639 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 117182542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000106436] [ENSMUST00000153953]
Predicted Effect probably benign
Transcript: ENSMUST00000065896
SMART Domains Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678

DomainStartEndE-ValueType
low complexity region 192 205 N/A INTRINSIC
KISc 252 590 1.04e-131 SMART
coiled coil region 615 647 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106436
SMART Domains Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
KISc 201 539 1.04e-131 SMART
coiled coil region 564 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148918
Predicted Effect probably benign
Transcript: ENSMUST00000153953
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin-like protein that functions as a microtubule-dependent molecular motor. The encoded protein can depolymerize microtubules at the plus end, thereby promoting mitotic chromosome segregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T G 7: 131,424,599 L57R probably damaging Het
Bmpr1b G A 3: 141,871,385 T55M possibly damaging Het
Cep350 G A 1: 155,953,762 T132I probably benign Het
Cops4 A T 5: 100,547,414 M400L probably benign Het
Cul1 G A 6: 47,523,213 D653N probably benign Het
Cyp3a13 C G 5: 137,919,056 L36F probably damaging Het
Dcaf10 T C 4: 45,342,558 F131L probably benign Het
Dgkh T C 14: 78,624,504 probably null Het
Igll1 C T 16: 16,861,057 V130M probably damaging Het
Klra7 T C 6: 130,218,958 D262G possibly damaging Het
Lrrc27 T C 7: 139,218,335 probably benign Het
Maf A G 8: 115,705,792 S358P probably benign Het
Map1a A G 2: 121,303,674 D1419G possibly damaging Het
Map3k1 G A 13: 111,755,979 A914V probably benign Het
Naa25 T G 5: 121,423,692 L436R possibly damaging Het
Ndc1 T C 4: 107,383,707 I294T probably damaging Het
Nek1 A C 8: 61,016,272 D121A probably damaging Het
Nfil3 C T 13: 52,968,710 G53R probably benign Het
Olfr63 T C 17: 33,269,336 V204A possibly damaging Het
Parp14 A T 16: 35,840,927 Y1550* probably null Het
Patl1 A G 19: 11,921,516 I192V probably damaging Het
Pax3 G A 1: 78,121,651 T367I probably damaging Het
Pla2g4a C T 1: 149,880,063 V208M probably damaging Het
Prdm10 A T 9: 31,337,323 K347M probably damaging Het
Prkd1 A T 12: 50,392,916 M376K probably benign Het
Prkg1 C T 19: 30,894,694 V219I possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox4 T C 13: 28,952,996 E9G probably damaging Het
Spon1 T A 7: 114,029,072 D354E probably damaging Het
Stat2 T A 10: 128,283,494 L450H probably damaging Het
Tek T A 4: 94,853,553 M849K probably damaging Het
Tmem63c G A 12: 87,075,726 D433N probably damaging Het
Tnpo3 G A 6: 29,589,033 T106I probably damaging Het
Tns1 G T 1: 73,918,033 A1674D possibly damaging Het
Trim8 T C 19: 46,515,410 V467A possibly damaging Het
Trmo T A 4: 46,382,568 H183L probably benign Het
Trpm1 C A 7: 64,268,962 C683* probably null Het
Vsig10 T G 5: 117,338,270 L263R probably damaging Het
Zfp874a A T 13: 67,442,693 Y291N probably benign Het
Other mutations in Kif2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Kif2c APN 4 117178246 missense probably benign 0.01
IGL01020:Kif2c APN 4 117166904 missense probably damaging 1.00
IGL01131:Kif2c APN 4 117172365 missense probably damaging 1.00
IGL02131:Kif2c APN 4 117177953 missense possibly damaging 0.88
IGL02455:Kif2c APN 4 117172354 missense probably benign
IGL02556:Kif2c APN 4 117162605 missense probably damaging 0.98
IGL03084:Kif2c APN 4 117178158 missense possibly damaging 0.67
IGL03333:Kif2c APN 4 117180636 missense possibly damaging 0.87
IGL03353:Kif2c APN 4 117166336 missense probably benign 0.19
R0025:Kif2c UTSW 4 117165517 missense probably damaging 1.00
R0466:Kif2c UTSW 4 117172292 missense possibly damaging 0.83
R1069:Kif2c UTSW 4 117178153 missense probably damaging 0.97
R1519:Kif2c UTSW 4 117169940 missense probably damaging 1.00
R1594:Kif2c UTSW 4 117178188 missense probably benign 0.02
R1789:Kif2c UTSW 4 117167361 missense probably benign 0.18
R1894:Kif2c UTSW 4 117162223 missense probably benign 0.02
R2340:Kif2c UTSW 4 117169841 missense probably damaging 1.00
R2830:Kif2c UTSW 4 117182448 splice site probably null
R3734:Kif2c UTSW 4 117162646 missense probably benign 0.02
R4634:Kif2c UTSW 4 117178240 missense probably benign 0.04
R4720:Kif2c UTSW 4 117171749 missense probably benign
R4908:Kif2c UTSW 4 117166411 missense probably damaging 1.00
R5076:Kif2c UTSW 4 117174869 unclassified probably benign
R6766:Kif2c UTSW 4 117167083 missense probably benign
R6767:Kif2c UTSW 4 117178188 missense probably benign 0.00
R6942:Kif2c UTSW 4 117166378 missense probably damaging 1.00
R7378:Kif2c UTSW 4 117162029 missense possibly damaging 0.46
R7526:Kif2c UTSW 4 117182432 missense possibly damaging 0.46
R7797:Kif2c UTSW 4 117171743 missense probably benign 0.00
R8087:Kif2c UTSW 4 117165418 missense possibly damaging 0.92
U24488:Kif2c UTSW 4 117182442 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTCAGTGTGGAATAAGGG -3'
(R):5'- ACCCTTCCCATCAGTCTCAGAG -3'

Sequencing Primer
(F):5'- TTTGCCACACGGAGATTCAG -3'
(R):5'- ATCAGTCTCAGAGCTCGGGAG -3'
Posted On2017-02-10