Incidental Mutation 'R5855:Cops4'
ID454859
Institutional Source Beutler Lab
Gene Symbol Cops4
Ensembl Gene ENSMUSG00000035297
Gene NameCOP9 signalosome subunit 4
SynonymsD5Ertd774e, COP9 complex S4
MMRRC Submission 043229-MU
Accession Numbers

Genbank: NM_012001; MGI: 1349414

Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5855 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100518309-100547803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100547414 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 400 (M400L)
Ref Sequence ENSEMBL: ENSMUSP00000048416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045993] [ENSMUST00000123492]
PDB Structure
Solution structure of the PCI domain [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000045993
AA Change: M400L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048416
Gene: ENSMUSG00000035297
AA Change: M400L

DomainStartEndE-ValueType
PINT 295 377 2.09e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123492
SMART Domains Protein: ENSMUSP00000119737
Gene: ENSMUSG00000035297

DomainStartEndE-ValueType
Pfam:PCI 179 251 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123559
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight subunits composing COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T G 7: 131,424,599 L57R probably damaging Het
Bmpr1b G A 3: 141,871,385 T55M possibly damaging Het
Cep350 G A 1: 155,953,762 T132I probably benign Het
Cul1 G A 6: 47,523,213 D653N probably benign Het
Cyp3a13 C G 5: 137,919,056 L36F probably damaging Het
Dcaf10 T C 4: 45,342,558 F131L probably benign Het
Dgkh T C 14: 78,624,504 probably null Het
Igll1 C T 16: 16,861,057 V130M probably damaging Het
Kif2c C T 4: 117,182,542 probably benign Het
Klra7 T C 6: 130,218,958 D262G possibly damaging Het
Lrrc27 T C 7: 139,218,335 probably benign Het
Maf A G 8: 115,705,792 S358P probably benign Het
Map1a A G 2: 121,303,674 D1419G possibly damaging Het
Map3k1 G A 13: 111,755,979 A914V probably benign Het
Naa25 T G 5: 121,423,692 L436R possibly damaging Het
Ndc1 T C 4: 107,383,707 I294T probably damaging Het
Nek1 A C 8: 61,016,272 D121A probably damaging Het
Nfil3 C T 13: 52,968,710 G53R probably benign Het
Olfr63 T C 17: 33,269,336 V204A possibly damaging Het
Parp14 A T 16: 35,840,927 Y1550* probably null Het
Patl1 A G 19: 11,921,516 I192V probably damaging Het
Pax3 G A 1: 78,121,651 T367I probably damaging Het
Pla2g4a C T 1: 149,880,063 V208M probably damaging Het
Prdm10 A T 9: 31,337,323 K347M probably damaging Het
Prkd1 A T 12: 50,392,916 M376K probably benign Het
Prkg1 C T 19: 30,894,694 V219I possibly damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Scn3a T C 2: 65,464,730 I1550V possibly damaging Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Sox4 T C 13: 28,952,996 E9G probably damaging Het
Spon1 T A 7: 114,029,072 D354E probably damaging Het
Stat2 T A 10: 128,283,494 L450H probably damaging Het
Tek T A 4: 94,853,553 M849K probably damaging Het
Tmem63c G A 12: 87,075,726 D433N probably damaging Het
Tnpo3 G A 6: 29,589,033 T106I probably damaging Het
Tns1 G T 1: 73,918,033 A1674D possibly damaging Het
Trim8 T C 19: 46,515,410 V467A possibly damaging Het
Trmo T A 4: 46,382,568 H183L probably benign Het
Trpm1 C A 7: 64,268,962 C683* probably null Het
Vsig10 T G 5: 117,338,270 L263R probably damaging Het
Zfp874a A T 13: 67,442,693 Y291N probably benign Het
Other mutations in Cops4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Cops4 APN 5 100533555 missense probably damaging 1.00
IGL02152:Cops4 APN 5 100533590 missense probably benign 0.20
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0326:Cops4 UTSW 5 100528542 missense probably damaging 0.99
R0494:Cops4 UTSW 5 100528662 missense probably damaging 0.97
R0639:Cops4 UTSW 5 100537460 missense possibly damaging 0.48
R1162:Cops4 UTSW 5 100530157 splice site probably benign
R1400:Cops4 UTSW 5 100533546 missense probably damaging 1.00
R4209:Cops4 UTSW 5 100547486 unclassified probably benign
R4943:Cops4 UTSW 5 100547426 missense probably benign 0.00
R5244:Cops4 UTSW 5 100533375 missense probably benign 0.00
R5350:Cops4 UTSW 5 100518539 missense possibly damaging 0.81
R6010:Cops4 UTSW 5 100543910 missense possibly damaging 0.63
R6026:Cops4 UTSW 5 100542328 unclassified probably benign
R7390:Cops4 UTSW 5 100543875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTTGCCAAGAGTCCCAG -3'
(R):5'- CGGGAGCTATTATGTTTAAACGATGC -3'

Sequencing Primer
(F):5'- TTCTTGCCAAGAGTCCCAGAATAAAC -3'
(R):5'- GCTATTATGTTTAAACGATGCACTTC -3'
Posted On2017-02-10