Incidental Mutation 'R0556:Mau2'
ID45566
Institutional Source Beutler Lab
Gene Symbol Mau2
Ensembl Gene ENSMUSG00000031858
Gene NameMAU2 sister chromatid cohesion factor
Synonyms
MMRRC Submission 038748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0556 (G1)
Quality Score153
Status Validated
Chromosome8
Chromosomal Location70016123-70042734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 70042432 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 85 (T85R)
Ref Sequence ENSEMBL: ENSMUSP00000148532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011450] [ENSMUST00000050561] [ENSMUST00000168013] [ENSMUST00000212308] [ENSMUST00000212451] [ENSMUST00000212845]
Predicted Effect probably benign
Transcript: ENSMUST00000011450
SMART Domains Protein: ENSMUSP00000011450
Gene: ENSMUSG00000011306

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
SWAP 185 239 8e-20 SMART
SWAP 260 314 4.09e-17 SMART
low complexity region 344 365 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
G_patch 558 605 3.25e-17 SMART
low complexity region 628 643 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050561
AA Change: T85R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054763
Gene: ENSMUSG00000031858
AA Change: T85R

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 575 5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168013
AA Change: T85R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131966
Gene: ENSMUSG00000031858
AA Change: T85R

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 576 8.7e-130 PFAM
Pfam:TPR_8 71 105 3.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212055
Predicted Effect probably damaging
Transcript: ENSMUST00000212308
AA Change: T85R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212401
Predicted Effect probably damaging
Transcript: ENSMUST00000212451
AA Change: T85R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212845
AA Change: T85R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213035
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,943,951 Y113* probably null Het
4930402F06Rik T C 2: 35,390,470 probably benign Het
4931406P16Rik T C 7: 34,239,797 T222A probably damaging Het
9530053A07Rik C T 7: 28,159,378 H2308Y probably benign Het
Acad11 A G 9: 104,115,302 E481G probably damaging Het
Aldh1a1 A T 19: 20,634,478 N389Y probably damaging Het
Bmpr2 C T 1: 59,815,328 T112M probably damaging Het
Bms1 A G 6: 118,413,179 Y227H probably damaging Het
Cab39 A G 1: 85,835,491 probably benign Het
Ccno T C 13: 112,988,286 probably null Het
Cct6b A G 11: 82,719,444 probably benign Het
Cd101 A C 3: 101,020,654 I37S probably damaging Het
Ces1a T C 8: 93,045,112 H19R probably benign Het
Clec16a A G 16: 10,638,785 probably null Het
Cntnap1 T C 11: 101,183,996 F831S probably benign Het
Col24a1 A G 3: 145,314,728 T287A possibly damaging Het
Colgalt2 C T 1: 152,471,813 probably benign Het
Cpd A G 11: 76,802,345 probably benign Het
Cyp3a16 C A 5: 145,455,980 M145I probably benign Het
Ddx54 T A 5: 120,619,654 probably benign Het
Dock7 A T 4: 98,945,189 L1925Q probably damaging Het
Eif4g1 A T 16: 20,675,794 Y127F probably damaging Het
Erap1 T A 13: 74,660,325 V52E probably damaging Het
Fbxo6 G T 4: 148,146,175 T210N probably damaging Het
Gnat3 T G 5: 18,019,598 V332G probably damaging Het
Ift22 T A 5: 136,911,291 probably null Het
Igkv4-71 A G 6: 69,243,187 C109R probably damaging Het
Igsf10 A G 3: 59,328,875 L1295P probably benign Het
Itga4 T C 2: 79,325,639 I983T probably benign Het
Lhcgr A T 17: 88,772,063 V65D probably damaging Het
Morc2a T C 11: 3,681,809 probably null Het
Morc2b A T 17: 33,137,838 M320K probably benign Het
Ms4a18 C A 19: 11,013,701 V10F probably damaging Het
Mstn A T 1: 53,064,125 I207F probably benign Het
Mtor A G 4: 148,469,380 E812G possibly damaging Het
Myo1h A G 5: 114,319,791 Y121C probably damaging Het
Nov A T 15: 54,749,167 T191S probably damaging Het
Olfr1196 A C 2: 88,700,771 V186G possibly damaging Het
Olfr743 T C 14: 50,533,924 S171P probably benign Het
Olfr920 A T 9: 38,755,745 D19V possibly damaging Het
Plcd3 G A 11: 103,077,806 T353M probably damaging Het
Pnpla7 T A 2: 25,052,301 probably null Het
Ppp1r12b T A 1: 134,777,322 Y876F probably damaging Het
Prelid2 T A 18: 41,951,180 probably benign Het
Prickle1 A G 15: 93,500,781 L722P probably benign Het
Prr12 A G 7: 45,030,669 L1887P unknown Het
Ptk2b A G 14: 66,172,144 L481P probably damaging Het
Rgl3 T A 9: 21,975,844 K531* probably null Het
Sacs A G 14: 61,183,958 I115V probably damaging Het
Sept3 G T 15: 82,283,765 probably benign Het
Simc1 T C 13: 54,525,347 S503P probably benign Het
Stard9 T C 2: 120,698,923 V1887A probably benign Het
Synj2 T A 17: 6,037,955 L1427* probably null Het
Taar2 A G 10: 23,940,895 D111G probably damaging Het
Tlr5 A G 1: 182,974,151 N340S probably damaging Het
Tmco2 A G 4: 121,109,117 L14P probably damaging Het
Tnik A T 3: 28,625,218 D746V possibly damaging Het
Trip11 C A 12: 101,884,518 E811* probably null Het
Ttll9 T C 2: 152,973,606 probably null Het
Uchl1 A G 5: 66,682,481 E122G probably benign Het
Vwa3b C A 1: 37,164,485 probably benign Het
Zan T C 5: 137,454,220 N1533S unknown Het
Zfp687 G T 3: 95,010,408 D684E probably damaging Het
Other mutations in Mau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Mau2 APN 8 70029245 splice site probably benign
IGL02353:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02360:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02990:Mau2 APN 8 70022255 splice site probably benign
PIT4382001:Mau2 UTSW 8 70030652 missense possibly damaging 0.95
R0378:Mau2 UTSW 8 70030655 missense probably damaging 0.99
R0558:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0731:Mau2 UTSW 8 70023612 critical splice donor site probably null
R0987:Mau2 UTSW 8 70027698 missense probably damaging 0.99
R1866:Mau2 UTSW 8 70031492 missense probably damaging 1.00
R2857:Mau2 UTSW 8 70019824 missense probably benign 0.08
R4852:Mau2 UTSW 8 70033177 critical splice donor site probably null
R4893:Mau2 UTSW 8 70030640 critical splice donor site probably null
R4970:Mau2 UTSW 8 70027703 missense possibly damaging 0.94
R5004:Mau2 UTSW 8 70025887 missense probably damaging 1.00
R5012:Mau2 UTSW 8 70031457 splice site probably null
R5248:Mau2 UTSW 8 70028723 missense probably benign 0.11
R6150:Mau2 UTSW 8 70019837 missense probably benign 0.23
R6178:Mau2 UTSW 8 70042537 missense probably damaging 0.96
R6343:Mau2 UTSW 8 70031523 missense probably damaging 0.99
R6649:Mau2 UTSW 8 70031516 missense possibly damaging 0.71
R6838:Mau2 UTSW 8 70039297 splice site probably null
R6959:Mau2 UTSW 8 70033228 missense probably damaging 1.00
R7365:Mau2 UTSW 8 70029234 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCTGAAGAGGGACAACTTTCCCG -3'
(R):5'- CCATAAGACCCAGAAGTCCTTGCG -3'

Sequencing Primer
(F):5'- GGACAACTTTCCCGGTTCC -3'
(R):5'- CAAGATggcggcacagg -3'
Posted On2013-06-11