Mutagenetix > Incidental Mutation

Incidental Mutation 'R5899:Ptgfr'

457717

Institutional Source

Beutler Lab

Gene Symbol

Ptgfr

Ensembl Gene

ENSMUSG00000028036

Gene Name

prostaglandin F receptor

Synonyms

FP, PGF

MMRRC Submission

044098-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R5899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151504247-151543165 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 151540738 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 257 (V257I)

Ref Sequence

ENSEMBL: ENSMUSP00000101732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]

AlphaFold

P43117

Predicted Effect

probably damaging
Transcript: ENSMUST00000029670
AA Change: V257I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: V257I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	23	304	6.8e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106126
AA Change: V257I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: V257I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	43	304	7.6e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197392

Meta Mutation Damage Score

0.0830

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.5%

Validation Efficiency

93% (56/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	T	C	10: 20,876,465 (GRCm39)	I792T	probably benign	Het
Anks1b	T	A	10: 90,759,379 (GRCm39)		probably null	Het
Ano3	T	G	2: 110,693,232 (GRCm39)	D122A	probably benign	Het
Atp12a	T	C	14: 56,610,801 (GRCm39)	V315A	probably benign	Het
B230104I21Rik	G	T	4: 154,433,986 (GRCm39)	G57*	probably null	Het
Bpifb2	A	G	2: 153,733,050 (GRCm39)	K378E	probably damaging	Het
Cdk5rap2	T	C	4: 70,161,830 (GRCm39)		probably benign	Het
Ceacam23	A	G	7: 17,651,369 (GRCm39)	D840G	possibly damaging	Het
Cflar	A	G	1: 58,791,927 (GRCm39)	D410G	probably benign	Het
Clcn6	A	G	4: 148,102,049 (GRCm39)	V345A	probably benign	Het
Cnga1	C	T	5: 72,776,404 (GRCm39)	V20I	possibly damaging	Het
Ddx50	T	A	10: 62,476,596 (GRCm39)	K226*	probably null	Het
Dnah5	T	C	15: 28,448,513 (GRCm39)	V4192A	possibly damaging	Het
Dnah8	G	A	17: 30,875,659 (GRCm39)	D494N	probably benign	Het
Dock7	A	T	4: 98,879,660 (GRCm39)	C965S	probably benign	Het
Dst	C	T	1: 34,334,370 (GRCm39)	A5083V	probably damaging	Het
E130208F15Rik	T	C	7: 30,021,726 (GRCm39)	Q10R	probably damaging	Het
Fbxw15	T	C	9: 109,384,741 (GRCm39)		probably null	Het
Fxr2	A	G	11: 69,543,511 (GRCm39)	N671D	probably damaging	Het
Gbp7	A	G	3: 142,252,303 (GRCm39)	T629A	probably benign	Het
Grm1	T	C	10: 10,565,092 (GRCm39)	Y1072C	probably benign	Het
Hmcn2	A	T	2: 31,244,685 (GRCm39)	E714V	possibly damaging	Het
Hsd17b13	T	A	5: 104,113,730 (GRCm39)	E205D	probably benign	Het
Igf2bp3	A	G	6: 49,094,084 (GRCm39)		probably benign	Het
Il2ra	A	G	2: 11,689,248 (GRCm39)	H259R	probably benign	Het
Klk15	G	T	7: 43,588,247 (GRCm39)	R185L	probably benign	Het
Map3k11	T	G	19: 5,745,937 (GRCm39)		probably null	Het
Morn3	A	G	5: 123,179,166 (GRCm39)	W95R	probably damaging	Het
Nipbl	A	G	15: 8,364,328 (GRCm39)		probably null	Het
Nrap	A	T	19: 56,329,006 (GRCm39)	V1145D	possibly damaging	Het
Or1e35	A	G	11: 73,797,755 (GRCm39)	S188P	probably damaging	Het
Or2l13b	C	T	16: 19,349,551 (GRCm39)	G40R	probably damaging	Het
Or9k2	T	A	10: 129,998,542 (GRCm39)	I218F	probably benign	Het
Pdcd11	A	G	19: 47,093,198 (GRCm39)	N492S	possibly damaging	Het
Racgap1	T	C	15: 99,521,509 (GRCm39)	E549G	possibly damaging	Het
Rfx3	T	C	19: 27,808,165 (GRCm39)	T193A	probably damaging	Het
Rplp0	T	A	5: 115,699,489 (GRCm39)	I149N	probably benign	Het
Samd7	T	G	3: 30,810,883 (GRCm39)	I300S	probably benign	Het
Scpep1	A	G	11: 88,825,402 (GRCm39)		probably null	Het
Senp6	T	C	9: 80,049,352 (GRCm39)		probably benign	Het
Serpinb2	G	T	1: 107,447,446 (GRCm39)	G78V	probably damaging	Het
Sesn1	T	C	10: 41,687,189 (GRCm39)	S58P	probably benign	Het
Skic3	A	G	13: 76,259,938 (GRCm39)		probably null	Het
Spg11	T	C	2: 121,928,680 (GRCm39)	D591G	possibly damaging	Het
Spire2	A	C	8: 124,080,833 (GRCm39)	S26R	probably damaging	Het
Strip2	T	A	6: 29,956,957 (GRCm39)		probably benign	Het
Ttn	G	A	2: 76,697,519 (GRCm39)		probably benign	Het
Vmn2r77	A	G	7: 86,460,924 (GRCm39)	Y750C	probably damaging	Het
Wnt11	T	A	7: 98,488,383 (GRCm39)	Y23*	probably null	Het
Zbp1	T	A	2: 173,052,340 (GRCm39)	D272V	probably benign	Het

Other mutations in Ptgfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Ptgfr	APN	3	151,541,323 (GRCm39)	missense	probably benign	0.43
IGL02085:Ptgfr	APN	3	151,541,437 (GRCm39)	missense	probably benign	0.00
IGL02110:Ptgfr	APN	3	151,541,097 (GRCm39)	missense	probably damaging	0.97
IGL02971:Ptgfr	APN	3	151,540,963 (GRCm39)	missense	probably benign	0.00
IGL03263:Ptgfr	APN	3	151,541,500 (GRCm39)	missense	probably benign	0.00
R0048:Ptgfr	UTSW	3	151,540,728 (GRCm39)	missense	possibly damaging	0.51
R0048:Ptgfr	UTSW	3	151,540,728 (GRCm39)	missense	possibly damaging	0.51
R0602:Ptgfr	UTSW	3	151,540,839 (GRCm39)	missense	probably damaging	1.00
R0624:Ptgfr	UTSW	3	151,540,839 (GRCm39)	missense	probably damaging	1.00
R0633:Ptgfr	UTSW	3	151,507,400 (GRCm39)	missense	probably benign	0.00
R1614:Ptgfr	UTSW	3	151,507,416 (GRCm39)	missense	probably benign	0.44
R1930:Ptgfr	UTSW	3	151,540,831 (GRCm39)	missense	probably benign	0.16
R1931:Ptgfr	UTSW	3	151,540,831 (GRCm39)	missense	probably benign	0.16
R1989:Ptgfr	UTSW	3	151,540,976 (GRCm39)	nonsense	probably null
R4596:Ptgfr	UTSW	3	151,507,430 (GRCm39)	missense	probably damaging	1.00
R6295:Ptgfr	UTSW	3	151,540,926 (GRCm39)	missense	probably benign	0.00
R6907:Ptgfr	UTSW	3	151,540,938 (GRCm39)	missense	possibly damaging	0.95
R7047:Ptgfr	UTSW	3	151,541,178 (GRCm39)	missense	possibly damaging	0.74
R7320:Ptgfr	UTSW	3	151,541,034 (GRCm39)	missense	probably benign	0.22
R8205:Ptgfr	UTSW	3	151,541,418 (GRCm39)	missense	probably benign	0.04
R8420:Ptgfr	UTSW	3	151,541,053 (GRCm39)	missense	possibly damaging	0.49
R9049:Ptgfr	UTSW	3	151,541,404 (GRCm39)	missense	probably benign	0.24
R9352:Ptgfr	UTSW	3	151,541,160 (GRCm39)	missense	probably damaging	1.00
R9537:Ptgfr	UTSW	3	151,541,445 (GRCm39)	missense	possibly damaging	0.91
Z1176:Ptgfr	UTSW	3	151,541,278 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTATGCCACATGGAAGCAGG -3'
(R):5'- CAGAGCACATCGAAGACTGG -3'

Sequencing Primer
(F):5'- AGAGTATGGCTACACCTGTTCAG -3'
(R):5'- GACTGGGAAGACAGATTTTATCTCC -3'

Posted On

2017-02-15