Incidental Mutation 'R7320:Ptgfr'
ID568120
Institutional Source Beutler Lab
Gene Symbol Ptgfr
Ensembl Gene ENSMUSG00000028036
Gene Nameprostaglandin F receptor
SynonymsFP, PGF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7320 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location151796502-151837630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151835397 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 158 (G158D)
Ref Sequence ENSEMBL: ENSMUSP00000029670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]
Predicted Effect probably benign
Transcript: ENSMUST00000029670
AA Change: G158D

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: G158D

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 6.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106126
AA Change: G158D

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: G158D

DomainStartEndE-ValueType
Pfam:7tm_1 43 304 7.6e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,464,303 K650* probably null Het
Abcc3 A G 11: 94,367,645 I458T probably benign Het
Adam29 A G 8: 55,872,714 I235T possibly damaging Het
AF529169 A G 9: 89,601,626 S573P probably benign Het
Afap1 G A 5: 35,948,223 V174I probably damaging Het
Ak8 A T 2: 28,812,992 D456V probably damaging Het
Alb T C 5: 90,464,987 probably null Het
Alox12 C T 11: 70,254,472 A92T probably benign Het
Arhgap23 T C 11: 97,451,545 S218P probably benign Het
Blm G A 7: 80,455,354 Q1389* probably null Het
C1ql4 A T 15: 99,087,724 V2E unknown Het
Casp12 A G 9: 5,348,897 probably null Het
Ccdc73 A T 2: 104,999,176 I1065F possibly damaging Het
Ccdc83 C T 7: 90,224,034 G371D probably damaging Het
Cfap65 A G 1: 74,926,604 S416P probably damaging Het
Cftr T A 6: 18,319,013 C1351S probably damaging Het
Clcn4 A T 7: 7,291,828 H311Q probably benign Het
Cldn13 T G 5: 134,915,020 I104L probably benign Het
Cul9 A G 17: 46,510,909 V1880A possibly damaging Het
Ddx17 A T 15: 79,531,904 D407E probably damaging Het
Ddx28 G A 8: 106,011,325 P34S probably damaging Het
Dnah5 A T 15: 28,270,470 N973Y probably null Het
Dock10 A G 1: 80,549,704 probably null Het
Dock3 T C 9: 106,895,524 D510G probably benign Het
Dst T A 1: 34,191,094 D2589E probably benign Het
E2f7 T C 10: 110,764,130 Y249H not run Het
Eef2kmt T C 16: 5,250,509 Y69C possibly damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exog G T 9: 119,462,478 V274L possibly damaging Het
Fam83e G A 7: 45,722,472 V98M probably benign Het
Fras1 C T 5: 96,709,886 T2013I probably benign Het
Gart G T 16: 91,621,681 A970E probably benign Het
Gga2 T A 7: 122,002,103 H259L probably benign Het
Glis3 C A 19: 28,531,598 V329F probably damaging Het
Gm6356 T A 14: 6,972,923 N53I probably damaging Het
Golgb1 C A 16: 36,915,951 C1894* probably null Het
Ifi203 T C 1: 173,929,167 N350S unknown Het
Isy1 T A 6: 87,833,706 R55S unknown Het
Itsn1 A T 16: 91,839,699 D678V unknown Het
Lhcgr T A 17: 88,742,078 R673S probably benign Het
Lnx2 C A 5: 147,020,133 R601L possibly damaging Het
Map4 A G 9: 110,081,517 T1093A probably benign Het
Mink1 A G 11: 70,599,073 K92E probably benign Het
Moxd1 A G 10: 24,301,465 I560V probably benign Het
Mrc2 C A 11: 105,329,235 D327E possibly damaging Het
Notch2 A G 3: 98,131,327 E1262G possibly damaging Het
Olfr1025-ps1 A T 2: 85,918,374 I150F probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1298 A G 2: 111,645,952 L15S probably benign Het
Olfr1434 G A 19: 12,283,816 G256D possibly damaging Het
Olfr1477 T A 19: 13,503,180 M279K possibly damaging Het
Olfr653 C A 7: 104,580,438 S264* probably null Het
Olfr785 A T 10: 129,409,785 T140S possibly damaging Het
Pcbp2 T A 15: 102,473,347 V5E probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pgghg A T 7: 140,943,040 Y104F probably benign Het
Plscr2 T C 9: 92,291,140 probably null Het
Ppfibp1 C T 6: 146,978,053 A25V probably damaging Het
Ptgs2 T C 1: 150,102,695 F186S probably damaging Het
Ptpn14 A G 1: 189,832,759 E181G probably benign Het
Rpgrip1 A G 14: 52,131,216 K291E possibly damaging Het
Rtn4rl1 T C 11: 75,194,296 probably null Het
Sema3b T A 9: 107,600,942 M415L probably benign Het
Sh3bp4 A G 1: 89,145,494 E688G probably damaging Het
Slco6c1 G A 1: 97,128,162 R5C possibly damaging Het
Slmap A G 14: 26,460,072 F369L possibly damaging Het
Sphk2 T C 7: 45,712,470 N181S possibly damaging Het
Sqor A G 2: 122,799,810 T235A probably benign Het
St13 A G 15: 81,389,653 L80P probably damaging Het
St3gal6 A G 16: 58,493,711 Y20H probably benign Het
Sun1 T G 5: 139,248,484 Y899D probably damaging Het
Synm C T 7: 67,735,380 E845K possibly damaging Het
Tg A T 15: 66,694,784 D1227V possibly damaging Het
Thbs1 A G 2: 118,114,957 N306D possibly damaging Het
Tmcc3 A T 10: 94,578,495 N51Y possibly damaging Het
Usp4 A G 9: 108,388,306 D856G probably benign Het
Vil1 G A 1: 74,418,444 A79T probably damaging Het
Vmn1r119 T A 7: 21,012,346 H37L probably damaging Het
Vmn2r110 A T 17: 20,596,054 M69K probably benign Het
Wdr78 A T 4: 103,050,187 I634N possibly damaging Het
Ywhaq A G 12: 21,394,981 L221P probably damaging Het
Zfp142 G A 1: 74,570,008 Q1543* probably null Het
Zfp384 T A 6: 125,024,830 M146K possibly damaging Het
Other mutations in Ptgfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Ptgfr APN 3 151835686 missense probably benign 0.43
IGL02085:Ptgfr APN 3 151835800 missense probably benign 0.00
IGL02110:Ptgfr APN 3 151835460 missense probably damaging 0.97
IGL02971:Ptgfr APN 3 151835326 missense probably benign 0.00
IGL03263:Ptgfr APN 3 151835863 missense probably benign 0.00
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0602:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0624:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0633:Ptgfr UTSW 3 151801763 missense probably benign 0.00
R1614:Ptgfr UTSW 3 151801779 missense probably benign 0.44
R1930:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1931:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1989:Ptgfr UTSW 3 151835339 nonsense probably null
R4596:Ptgfr UTSW 3 151801793 missense probably damaging 1.00
R5899:Ptgfr UTSW 3 151835101 missense probably damaging 0.96
R6295:Ptgfr UTSW 3 151835289 missense probably benign 0.00
R6907:Ptgfr UTSW 3 151835301 missense possibly damaging 0.95
R7047:Ptgfr UTSW 3 151835541 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAGAGTGTGACTCCCGTGAC -3'
(R):5'- CTGATAAAGACTGGATCCGCTTTG -3'

Sequencing Primer
(F):5'- TGACGGCATTGCACGAG -3'
(R):5'- AAGACTGGATCCGCTTTGATCAGTC -3'
Posted On2019-06-26