Incidental Mutation 'R6003:Vps52'
ID 478480
Institutional Source Beutler Lab
Gene Symbol Vps52
Ensembl Gene ENSMUSG00000024319
Gene Name VPS52 GARP complex subunit
Synonyms tclw5, ARE1, D430041K17Rik, tcl-w5, Sacm2l
MMRRC Submission 043252-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6003 (G1)
Quality Score 95.0077
Status Not validated
Chromosome 17
Chromosomal Location 34174786-34186009 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 34175068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000133926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000173196] [ENSMUST00000174609]
AlphaFold Q8C754
Predicted Effect probably benign
Transcript: ENSMUST00000008812
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025178
AA Change: M1K
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087543
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect probably null
Transcript: ENSMUST00000173196
AA Change: M1K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect probably benign
Transcript: ENSMUST00000174609
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,112,312 (GRCm39) E157G probably benign Het
Abcb11 T C 2: 69,073,811 (GRCm39) K1238R probably benign Het
Ankar T A 1: 72,738,046 (GRCm39) E45D probably damaging Het
Antxrl G T 14: 33,797,592 (GRCm39) K522N possibly damaging Het
Ap1m1 A G 8: 73,003,011 (GRCm39) Y93C probably damaging Het
As3mt C T 19: 46,696,567 (GRCm39) T35M possibly damaging Het
Aspg T C 12: 112,079,476 (GRCm39) S85P probably damaging Het
Cachd1 T C 4: 100,809,216 (GRCm39) S234P possibly damaging Het
Ccdc3 T C 2: 5,146,218 (GRCm39) probably null Het
Cnpy1 T C 5: 28,450,759 (GRCm39) T16A probably benign Het
Cope T C 8: 70,757,285 (GRCm39) L43P probably benign Het
E2f8 T C 7: 48,520,525 (GRCm39) M599V probably benign Het
Eif3a A T 19: 60,755,319 (GRCm39) D954E unknown Het
Gfpt1 T A 6: 87,065,230 (GRCm39) probably null Het
Ggps1 T G 13: 14,228,587 (GRCm39) S145R probably benign Het
Gon4l A G 3: 88,803,400 (GRCm39) D1337G probably damaging Het
Gtf2a1l G T 17: 89,001,531 (GRCm39) G82V probably damaging Het
Gucy1b1 C A 3: 81,965,584 (GRCm39) L87F probably damaging Het
Hoxc9 T C 15: 102,890,311 (GRCm39) V76A probably benign Het
Ints2 T C 11: 86,129,294 (GRCm39) E460G probably damaging Het
Kdm4b C T 17: 56,703,916 (GRCm39) R756W probably damaging Het
Lax1 T A 1: 133,611,834 (GRCm39) I34F probably benign Het
Marveld3 A T 8: 110,680,960 (GRCm39) C312S probably damaging Het
Ncoa2 T C 1: 13,237,254 (GRCm39) D824G possibly damaging Het
Nrxn2 C A 19: 6,548,358 (GRCm39) A17D possibly damaging Het
Nup133 A T 8: 124,665,031 (GRCm39) I220N probably damaging Het
Nup205 T C 6: 35,189,751 (GRCm39) V984A probably benign Het
Nup54 A T 5: 92,570,853 (GRCm39) D318E probably damaging Het
Obp2a A T 2: 25,591,151 (GRCm39) K94N probably damaging Het
Or2ak5 A T 11: 58,611,196 (GRCm39) I226N probably benign Het
Or5b3 T C 19: 13,388,403 (GRCm39) S157P probably benign Het
Pappa2 T C 1: 158,763,820 (GRCm39) I564V probably benign Het
Parpbp A G 10: 87,969,020 (GRCm39) V142A possibly damaging Het
Rdh16f2 A T 10: 127,712,201 (GRCm39) R219S probably benign Het
Rfx6 C T 10: 51,584,683 (GRCm39) R228C probably damaging Het
Rpap2 A G 5: 107,749,767 (GRCm39) probably null Het
Rskr T G 11: 78,183,846 (GRCm39) probably null Het
Slc15a2 T C 16: 36,574,910 (GRCm39) I531V probably benign Het
Srebf1 T C 11: 60,097,930 (GRCm39) E58G possibly damaging Het
Tmem214 C A 5: 31,028,068 (GRCm39) T96K possibly damaging Het
Usp19 T C 9: 108,373,579 (GRCm39) Y691H probably damaging Het
Vmn1r86 C T 7: 12,836,125 (GRCm39) W200* probably null Het
Vmn2r8 A T 5: 108,945,248 (GRCm39) S786R probably damaging Het
Zzef1 T A 11: 72,714,891 (GRCm39) probably null Het
Other mutations in Vps52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Vps52 APN 17 34,175,932 (GRCm39) missense possibly damaging 0.96
IGL01098:Vps52 APN 17 34,181,704 (GRCm39) missense possibly damaging 0.90
IGL01705:Vps52 APN 17 34,185,042 (GRCm39) missense probably damaging 1.00
IGL01722:Vps52 APN 17 34,180,589 (GRCm39) nonsense probably null
IGL02992:Vps52 APN 17 34,177,324 (GRCm39) missense probably damaging 0.97
IGL03279:Vps52 APN 17 34,176,848 (GRCm39) missense probably damaging 0.96
R0363:Vps52 UTSW 17 34,181,091 (GRCm39) missense probably benign 0.26
R0762:Vps52 UTSW 17 34,178,985 (GRCm39) missense probably damaging 1.00
R1065:Vps52 UTSW 17 34,180,213 (GRCm39) missense probably benign 0.02
R1506:Vps52 UTSW 17 34,176,868 (GRCm39) missense probably damaging 1.00
R3760:Vps52 UTSW 17 34,179,162 (GRCm39) missense possibly damaging 0.64
R4714:Vps52 UTSW 17 34,180,153 (GRCm39) missense probably benign 0.25
R5381:Vps52 UTSW 17 34,177,275 (GRCm39) missense possibly damaging 0.77
R5590:Vps52 UTSW 17 34,180,195 (GRCm39) missense probably benign 0.01
R5928:Vps52 UTSW 17 34,180,100 (GRCm39) missense possibly damaging 0.85
R6302:Vps52 UTSW 17 34,182,189 (GRCm39) missense probably damaging 1.00
R6574:Vps52 UTSW 17 34,181,452 (GRCm39) missense probably null 0.34
R6695:Vps52 UTSW 17 34,182,173 (GRCm39) nonsense probably null
R6888:Vps52 UTSW 17 34,182,180 (GRCm39) missense probably benign 0.06
R7022:Vps52 UTSW 17 34,178,293 (GRCm39) missense probably benign 0.04
R7136:Vps52 UTSW 17 34,184,262 (GRCm39) missense probably benign 0.00
R7380:Vps52 UTSW 17 34,177,283 (GRCm39) missense possibly damaging 0.82
R7727:Vps52 UTSW 17 34,181,108 (GRCm39) missense probably benign 0.21
R7888:Vps52 UTSW 17 34,184,725 (GRCm39) missense probably damaging 0.98
R8385:Vps52 UTSW 17 34,181,791 (GRCm39) missense probably damaging 1.00
R8956:Vps52 UTSW 17 34,177,049 (GRCm39) missense probably benign 0.01
R9457:Vps52 UTSW 17 34,181,156 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTCCGGAACAGAGTTGTG -3'
(R):5'- GCTCCGAACCTCTTGTCTAAATG -3'

Sequencing Primer
(F):5'- CTGTTTGCACTTGACCGAAATG -3'
(R):5'- TGTCTAAATGGAGCCTACGC -3'
Posted On 2017-06-26