Incidental Mutation 'R6086:Rab11fip4'
ID482496
Institutional Source Beutler Lab
Gene Symbol Rab11fip4
Ensembl Gene ENSMUSG00000017639
Gene NameRAB11 family interacting protein 4 (class II)
SynonymsA730072L08Rik, RAB11-FIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6086 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79591212-79698023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79683480 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 132 (D132N)
Ref Sequence ENSEMBL: ENSMUSP00000114971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017783] [ENSMUST00000155381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017783
AA Change: D234N

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017783
Gene: ENSMUSG00000017639
AA Change: D234N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
SCOP:d1mr8a_ 17 90 2e-4 SMART
Blast:EFh 54 81 2e-10 BLAST
low complexity region 247 252 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Blast:BRLZ 507 574 7e-24 BLAST
Pfam:RBD-FIP 594 634 1.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155381
AA Change: D132N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with RAB11 and is thought to be involved in bringing recycling endosome membranes to the cleavage furrow in late cytokinesis. Hypoxic conditions can lead to an upregulation of the encoded protein and enhance the metastatic potential of hepatocellular carcinoma. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Enpp2 T C 15: 54,845,834 D795G probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hspa1l T C 17: 34,978,155 V390A possibly damaging Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Ncapg T C 5: 45,693,236 L728P probably damaging Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1230 A G 2: 89,296,854 C139R probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema3b T C 9: 107,600,848 D446G probably damaging Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zfp955b T A 17: 33,302,504 W316R probably benign Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Rab11fip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Rab11fip4 APN 11 79691879 missense possibly damaging 0.70
IGL01867:Rab11fip4 APN 11 79683390 missense probably benign 0.04
R0013:Rab11fip4 UTSW 11 79689653 missense probably benign 0.27
R0277:Rab11fip4 UTSW 11 79686629 missense possibly damaging 0.82
R0737:Rab11fip4 UTSW 11 79683502 missense probably benign
R4975:Rab11fip4 UTSW 11 79619671 missense probably damaging 1.00
R5382:Rab11fip4 UTSW 11 79690715 missense possibly damaging 0.94
R5982:Rab11fip4 UTSW 11 79690775 missense probably benign
R6267:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R6296:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R7468:Rab11fip4 UTSW 11 79689652 missense probably benign 0.02
R8156:Rab11fip4 UTSW 11 79686589 missense probably benign 0.00
R8307:Rab11fip4 UTSW 11 79690774 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CAGGCTCCTGTGATCTGTTG -3'
(R):5'- CAGATGTAAGACGGTGGCAC -3'

Posted On2017-07-14