Incidental Mutation 'R6118:Antxr2'
ID485204
Institutional Source Beutler Lab
Gene Symbol Antxr2
Ensembl Gene ENSMUSG00000029338
Gene Nameanthrax toxin receptor 2
Synonyms2310046B19Rik, CMG2, CMG-2, cI-35
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location97882783-98031043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97949201 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 351 (D351V)
Ref Sequence ENSEMBL: ENSMUSP00000142605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031281] [ENSMUST00000199088]
Predicted Effect probably damaging
Transcript: ENSMUST00000031281
AA Change: D351V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031281
Gene: ENSMUSG00000029338
AA Change: D351V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
VWA 42 214 2.86e-18 SMART
Pfam:Anth_Ig 215 317 4e-38 PFAM
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 485 7.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199088
AA Change: D351V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142605
Gene: ENSMUSG00000029338
AA Change: D351V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
VWA 42 214 1.7e-20 SMART
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 483 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202736
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for null mutations display female infertility. Mice homozygous for one allele are highly resistant to Bacillus anthracis or anthrax toxin induced lethality. Young mice homozygous for a second allele display pregnancy-related premature death and failure of parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Antxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Antxr2 APN 5 97886607 splice site probably benign
IGL00661:Antxr2 APN 5 98004296 missense probably benign 0.26
IGL01105:Antxr2 APN 5 98004943 splice site probably benign
IGL01472:Antxr2 APN 5 98027499 missense probably benign 0.00
IGL01719:Antxr2 APN 5 97948273 missense possibly damaging 0.82
IGL02184:Antxr2 APN 5 97977595 splice site probably null
IGL02199:Antxr2 APN 5 97977595 splice site probably null
IGL02250:Antxr2 APN 5 97977595 splice site probably null
IGL02251:Antxr2 APN 5 97977595 splice site probably null
IGL02368:Antxr2 APN 5 97949198 missense probably damaging 1.00
IGL02447:Antxr2 APN 5 98030408 missense possibly damaging 0.61
IGL02740:Antxr2 APN 5 98030392 splice site probably benign
IGL02850:Antxr2 APN 5 98004078 missense probably damaging 1.00
IGL02867:Antxr2 APN 5 97977650 missense probably benign 0.00
IGL02889:Antxr2 APN 5 97977650 missense probably benign 0.00
R0013:Antxr2 UTSW 5 97979985 missense probably damaging 0.98
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0069:Antxr2 UTSW 5 97948250 missense possibly damaging 0.95
R0184:Antxr2 UTSW 5 97980030 missense probably damaging 1.00
R0367:Antxr2 UTSW 5 98029596 missense probably benign 0.01
R0638:Antxr2 UTSW 5 97960637 nonsense probably null
R0732:Antxr2 UTSW 5 97960708 splice site probably null
R1255:Antxr2 UTSW 5 97975372 missense probably benign 0.39
R1471:Antxr2 UTSW 5 97975340 missense possibly damaging 0.88
R1520:Antxr2 UTSW 5 97960692 missense probably benign 0.38
R1660:Antxr2 UTSW 5 97975350 nonsense probably null
R1870:Antxr2 UTSW 5 98030438 missense probably damaging 1.00
R2969:Antxr2 UTSW 5 98030416 nonsense probably null
R3547:Antxr2 UTSW 5 97977657 missense probably benign 0.09
R4237:Antxr2 UTSW 5 97938407 missense probably damaging 1.00
R4660:Antxr2 UTSW 5 98004054 critical splice donor site probably null
R4702:Antxr2 UTSW 5 97949169 critical splice donor site probably null
R4893:Antxr2 UTSW 5 98004072 missense probably damaging 1.00
R4997:Antxr2 UTSW 5 97977694 missense probably benign 0.04
R5388:Antxr2 UTSW 5 97977599 critical splice donor site probably null
R5604:Antxr2 UTSW 5 97948310 missense probably damaging 0.98
R6093:Antxr2 UTSW 5 98030460 missense probably damaging 0.99
R6130:Antxr2 UTSW 5 98004272 missense possibly damaging 0.89
R6139:Antxr2 UTSW 5 97977706 splice site probably null
R6992:Antxr2 UTSW 5 97960705 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGGCCGATTCCTCTAGTAC -3'
(R):5'- CCCTTCTTAATAAAGGGGCTATAGAC -3'

Sequencing Primer
(F):5'- GGCCGATTCCTCTAGTACCTAGTATC -3'
(R):5'- AGACTTCATAACTTTAAGTCAGCTTC -3'
Posted On2017-08-16