Incidental Mutation 'R0638:Antxr2'
ID56807
Institutional Source Beutler Lab
Gene Symbol Antxr2
Ensembl Gene ENSMUSG00000029338
Gene Nameanthrax toxin receptor 2
Synonyms2310046B19Rik, CMG2, CMG-2, cI-35
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0638 (G1)
Quality Score189
Status Validated
Chromosome5
Chromosomal Location97882783-98031043 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 97960637 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 338 (W338*)
Ref Sequence ENSEMBL: ENSMUSP00000142605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031281] [ENSMUST00000199088]
Predicted Effect probably null
Transcript: ENSMUST00000031281
AA Change: W338*
SMART Domains Protein: ENSMUSP00000031281
Gene: ENSMUSG00000029338
AA Change: W338*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
VWA 42 214 2.86e-18 SMART
Pfam:Anth_Ig 215 317 4e-38 PFAM
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 485 7.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199088
AA Change: W338*
SMART Domains Protein: ENSMUSP00000142605
Gene: ENSMUSG00000029338
AA Change: W338*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
VWA 42 214 1.7e-20 SMART
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 483 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202736
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for null mutations display female infertility. Mice homozygous for one allele are highly resistant to Bacillus anthracis or anthrax toxin induced lethality. Young mice homozygous for a second allele display pregnancy-related premature death and failure of parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Antxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Antxr2 APN 5 97886607 splice site probably benign
IGL00661:Antxr2 APN 5 98004296 missense probably benign 0.26
IGL01105:Antxr2 APN 5 98004943 splice site probably benign
IGL01472:Antxr2 APN 5 98027499 missense probably benign 0.00
IGL01719:Antxr2 APN 5 97948273 missense possibly damaging 0.82
IGL02184:Antxr2 APN 5 97977595 splice site probably null
IGL02199:Antxr2 APN 5 97977595 splice site probably null
IGL02250:Antxr2 APN 5 97977595 splice site probably null
IGL02251:Antxr2 APN 5 97977595 splice site probably null
IGL02368:Antxr2 APN 5 97949198 missense probably damaging 1.00
IGL02447:Antxr2 APN 5 98030408 missense possibly damaging 0.61
IGL02740:Antxr2 APN 5 98030392 splice site probably benign
IGL02850:Antxr2 APN 5 98004078 missense probably damaging 1.00
IGL02867:Antxr2 APN 5 97977650 missense probably benign 0.00
IGL02889:Antxr2 APN 5 97977650 missense probably benign 0.00
R0013:Antxr2 UTSW 5 97979985 missense probably damaging 0.98
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0069:Antxr2 UTSW 5 97948250 missense possibly damaging 0.95
R0184:Antxr2 UTSW 5 97980030 missense probably damaging 1.00
R0367:Antxr2 UTSW 5 98029596 missense probably benign 0.01
R0732:Antxr2 UTSW 5 97960708 splice site probably null
R1255:Antxr2 UTSW 5 97975372 missense probably benign 0.39
R1471:Antxr2 UTSW 5 97975340 missense possibly damaging 0.88
R1520:Antxr2 UTSW 5 97960692 missense probably benign 0.38
R1660:Antxr2 UTSW 5 97975350 nonsense probably null
R1870:Antxr2 UTSW 5 98030438 missense probably damaging 1.00
R2969:Antxr2 UTSW 5 98030416 nonsense probably null
R3547:Antxr2 UTSW 5 97977657 missense probably benign 0.09
R4237:Antxr2 UTSW 5 97938407 missense probably damaging 1.00
R4660:Antxr2 UTSW 5 98004054 critical splice donor site probably null
R4702:Antxr2 UTSW 5 97949169 critical splice donor site probably null
R4893:Antxr2 UTSW 5 98004072 missense probably damaging 1.00
R4997:Antxr2 UTSW 5 97977694 missense probably benign 0.04
R5388:Antxr2 UTSW 5 97977599 critical splice donor site probably null
R5604:Antxr2 UTSW 5 97948310 missense probably damaging 0.98
R6093:Antxr2 UTSW 5 98030460 missense probably damaging 0.99
R6118:Antxr2 UTSW 5 97949201 missense probably damaging 1.00
R6130:Antxr2 UTSW 5 98004272 missense possibly damaging 0.89
R6139:Antxr2 UTSW 5 97977706 splice site probably null
R6992:Antxr2 UTSW 5 97960705 missense probably benign 0.09
R8127:Antxr2 UTSW 5 97980017 nonsense probably null
R8267:Antxr2 UTSW 5 97965762 critical splice acceptor site probably null
R8301:Antxr2 UTSW 5 97977679 missense probably benign 0.20
R8324:Antxr2 UTSW 5 97938509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTGGTGGAAAGCAGCATCC -3'
(R):5'- CCCAGTGTGGGCTTCTTACAAAGG -3'

Sequencing Primer
(F):5'- GAGTGGAAATGACTTTCATCCC -3'
(R):5'- TGTGGGCTTCTTACAAAGGATAAAG -3'
Posted On2013-07-11