Incidental Mutation 'R0523:Nt5c3'
ID48700
Institutional Source Beutler Lab
Gene Symbol Nt5c3
Ensembl Gene ENSMUSG00000029780
Gene Name5'-nucleotidase, cytosolic III
SynonymsUmph1, 2610206B05Rik, PN-1, p36, lupin, cN-III, 1600024P05Rik, PSN1, Umph-1, PN-I
MMRRC Submission 038716-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0523 (G1)
Quality Score200
Status Not validated
Chromosome6
Chromosomal Location56882400-56923932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56883681 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 296 (N296K)
Ref Sequence ENSEMBL: ENSMUSP00000031793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031793] [ENSMUST00000031795] [ENSMUST00000101367] [ENSMUST00000135558] [ENSMUST00000152447]
PDB Structure
X-Ray Structure of a Cytosolic 5'-Nucleotidase III from Mus Musculus MM.158936 [X-RAY DIFFRACTION]
X-ray structure of mouse pyrimidine 5'-nucleotidase type 1, with bound magnesium(II) [X-RAY DIFFRACTION]
X-ray structure of mouse pyrimidine 5'-nucleotidase type 1, phospho-enzyme intermediate analog with Beryllium fluoride [X-RAY DIFFRACTION]
X-ray structure of mouse pyrimidine 5'-nucleotidase type 1, product-transition complex analog with Aluminum fluoride [X-RAY DIFFRACTION]
X-ray structure of mouse pyrimidine 5'-nucleotidase type 1, product complex [X-RAY DIFFRACTION]
X-ray structure of mouse pyrimidine 5'-nucleotidase type 1 with lead(II) bound in active site [X-RAY DIFFRACTION]
Ensemble refinement of the protein crystal structure of a cytosolic 5'-nucleotidase III from Mus musculus Mm.158936 [X-RAY DIFFRACTION]
Structure of murine cytosolic 5'-nucleotidase III complexed with uridinine monophosphate [X-RAY DIFFRACTION]
Structure of murine cytosolic 5'-nucleotidase III complexed with thymidine monophosphate [X-RAY DIFFRACTION]
Cytosolic 5'-nucleotidase III complexed with cytidine 5'-monophosphate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031793
AA Change: N296K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031793
Gene: ENSMUSG00000029780
AA Change: N296K

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:UMPH-1 86 331 5.6e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031795
SMART Domains Protein: ENSMUSP00000031795
Gene: ENSMUSG00000029781

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:FKBP_C 47 139 8.2e-31 PFAM
Pfam:FKBP_C 159 251 5.8e-28 PFAM
Pfam:FKBP_C 271 362 1.3e-27 PFAM
Pfam:FKBP_C 382 474 2.8e-27 PFAM
EFh 492 520 2.35e0 SMART
EFh 537 565 1.98e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101367
AA Change: N262K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098918
Gene: ENSMUSG00000029780
AA Change: N262K

DomainStartEndE-ValueType
Pfam:UMPH-1 52 297 2.1e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126137
Predicted Effect probably benign
Transcript: ENSMUST00000135558
SMART Domains Protein: ENSMUSP00000145230
Gene: ENSMUSG00000029780

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152447
Predicted Effect probably benign
Transcript: ENSMUST00000205087
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
A2ml1 T C 6: 128,558,326 D807G possibly damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Aggf1 T C 13: 95,356,416 I562V probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
BC051142 G T 17: 34,445,499 probably null Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 probably benign Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 probably benign Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
Dpyd G A 3: 118,899,203 R332K probably benign Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G probably benign Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 probably null Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T582A probably benign Het
Notch2 C T 3: 98,070,970 T89I probably benign Het
Notch2 G A 3: 98,111,598 R692H probably benign Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pde1c T A 6: 56,174,941 L252F probably damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L156Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tgm3 T C 2: 130,044,662 probably null Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R164* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in Nt5c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Nt5c3 APN 6 56886685 missense probably damaging 1.00
IGL02819:Nt5c3 APN 6 56883733 missense probably damaging 1.00
R0426:Nt5c3 UTSW 6 56883812 missense probably benign
R0791:Nt5c3 UTSW 6 56886749 missense probably benign 0.02
R0792:Nt5c3 UTSW 6 56886749 missense probably benign 0.02
R1340:Nt5c3 UTSW 6 56883033 missense probably benign 0.02
R3703:Nt5c3 UTSW 6 56883667 unclassified probably benign
R5942:Nt5c3 UTSW 6 56897854 intron probably null
R6047:Nt5c3 UTSW 6 56882979 missense probably damaging 0.99
R6894:Nt5c3 UTSW 6 56882973 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGGGCAGCTTTGCACAAG -3'
(R):5'- TCAACAAACACGATGGTGCCCTG -3'

Sequencing Primer
(F):5'- TTCTGACACTCATGACTAGGGAG -3'
(R):5'- CGATGGTGCCCTGAAGAATAC -3'
Posted On2013-06-12