Incidental Mutation 'R6130:Abi3'
ID487102
Institutional Source Beutler Lab
Gene Symbol Abi3
Ensembl Gene ENSMUSG00000018381
Gene NameABI gene family, member 3
Synonyms
MMRRC Submission 044277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6130 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95830074-95842476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95837095 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 90 (E90V)
Ref Sequence ENSEMBL: ENSMUSP00000061893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000107712] [ENSMUST00000133070]
Predicted Effect probably benign
Transcript: ENSMUST00000054173
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059026
AA Change: E90V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381
AA Change: E90V

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107712
SMART Domains Protein: ENSMUSP00000103340
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137645
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143492
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Adgrv1 A C 13: 81,427,745 V4834G probably damaging Het
Aen A T 7: 78,902,639 probably null Het
Ankrd55 A G 13: 112,318,446 D26G probably damaging Het
Antxr2 T C 5: 98,004,272 E160G possibly damaging Het
Auts2 T C 5: 131,440,223 H528R probably damaging Het
Casd1 A G 6: 4,641,948 T742A probably damaging Het
Ccdc39 T C 3: 33,841,192 probably null Het
Ctla4 T C 1: 60,912,491 Y60H probably damaging Het
Dennd4b T C 3: 90,276,259 L935P probably damaging Het
Dnah6 T A 6: 73,188,494 T543S probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Fdxacb1 C T 9: 50,772,602 R420* probably null Het
Flg A G 3: 93,292,716 probably benign Het
Fpr1 T A 17: 17,877,635 I31F probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gsta1 T A 9: 78,242,565 F220Y probably damaging Het
Hmg20a T A 9: 56,488,607 probably null Het
Igf2bp1 A C 11: 95,974,020 L201R probably damaging Het
Jph3 G A 8: 121,753,087 R168H probably damaging Het
Kif1a T A 1: 93,036,901 I1318F probably damaging Het
Lamc2 T C 1: 153,136,777 N717S probably benign Het
Lepr A T 4: 101,765,372 S450C probably damaging Het
Muc16 A G 9: 18,590,698 V6535A probably damaging Het
Myom3 A G 4: 135,762,571 T18A probably benign Het
Nlrp5 A G 7: 23,404,173 K22E probably benign Het
Obscn A C 11: 59,077,945 S2534A possibly damaging Het
Olfr318 A G 11: 58,720,307 V247A probably damaging Het
Olfr50 A T 2: 36,794,043 D269V probably benign Het
Pcdhga8 T A 18: 37,727,527 N545K possibly damaging Het
Pcsk5 A T 19: 17,511,556 Y967N probably damaging Het
Ppp1r32 G A 19: 10,477,764 P233L probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scap A G 9: 110,380,379 T707A possibly damaging Het
Scarf1 A G 11: 75,525,739 Q669R probably benign Het
Scin T C 12: 40,069,436 D531G probably benign Het
Sh2b3 T C 5: 121,815,563 probably null Het
Slco1a6 T C 6: 142,086,429 S657G probably benign Het
Stil T A 4: 115,029,861 probably null Het
Syna T A 5: 134,558,268 Q609L possibly damaging Het
Tmem59l A G 8: 70,484,605 S271P probably damaging Het
Tns2 A G 15: 102,111,241 E522G probably damaging Het
Trappc6a G A 7: 19,515,294 A149T probably benign Het
Trim21 A T 7: 102,563,291 L156H possibly damaging Het
Trpv3 A G 11: 73,296,483 R714G possibly damaging Het
Wdr63 A C 3: 146,042,804 Y852D probably benign Het
Zfp72 T A 13: 74,372,341 Q206L possibly damaging Het
Other mutations in Abi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Abi3 APN 11 95835799 missense probably damaging 1.00
R0045:Abi3 UTSW 11 95832715 makesense probably null
R0626:Abi3 UTSW 11 95837111 missense probably benign 0.28
R0690:Abi3 UTSW 11 95833634 unclassified probably benign
R4653:Abi3 UTSW 11 95832811 missense probably benign 0.34
R5358:Abi3 UTSW 11 95842108 missense probably benign 0.21
R5881:Abi3 UTSW 11 95834387 missense probably damaging 1.00
R5881:Abi3 UTSW 11 95834388 missense probably damaging 1.00
R6020:Abi3 UTSW 11 95842025 nonsense probably null
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6388:Abi3 UTSW 11 95833638 critical splice donor site probably null
R6963:Abi3 UTSW 11 95832741 unclassified probably benign
R7867:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
R7950:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CACAGCCATGATAGATGTCTCC -3'
(R):5'- CAAGTTCAGCTCTGGCCTTC -3'

Sequencing Primer
(F):5'- GCCATGATAGATGTCTCCAAAGTCTG -3'
(R):5'- TCCGACTCTGCCAAGGAAG -3'
Posted On2017-10-10