Incidental Mutation 'R6143:Irgm2'
ID488690
Institutional Source Beutler Lab
Gene Symbol Irgm2
Ensembl Gene ENSMUSG00000069874
Gene Nameimmunity-related GTPase family M member 2
SynonymsGtpi, Iigp2
MMRRC Submission 044290-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6143 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58199618-58222782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58220609 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 387 (E387D)
Ref Sequence ENSEMBL: ENSMUSP00000146805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058704] [ENSMUST00000108836] [ENSMUST00000209079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058704
AA Change: E375D

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056001
Gene: ENSMUSG00000069874
AA Change: E375D

DomainStartEndE-ValueType
Pfam:IIGP 30 387 8.1e-165 PFAM
Pfam:MMR_HSR1 66 179 9.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108836
AA Change: E375D

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104464
Gene: ENSMUSG00000069874
AA Change: E375D

DomainStartEndE-ValueType
Pfam:IIGP 30 387 4.9e-164 PFAM
Pfam:MMR_HSR1 66 179 2.2e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209079
AA Change: E387D

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A G 14: 55,560,279 probably benign Het
Abcd2 A T 15: 91,190,947 V221E possibly damaging Het
Arhgap39 T A 15: 76,730,406 K853* probably null Het
Art2a-ps T C 7: 101,555,223 D36G possibly damaging Het
Atp13a1 C T 8: 69,805,360 P922S probably benign Het
Brwd1 C T 16: 96,002,956 G2005R probably benign Het
Bzw2 A T 12: 36,120,726 M133K probably benign Het
Cacna1s T G 1: 136,076,758 S346A probably damaging Het
Cebpb C A 2: 167,689,300 D93E probably benign Het
Cep162 C A 9: 87,212,851 probably null Het
Col9a2 A T 4: 121,053,863 Y565F probably damaging Het
Csgalnact1 T A 8: 68,373,550 N372I probably damaging Het
Csmd1 T C 8: 16,088,301 D1579G probably damaging Het
Cyfip2 A C 11: 46,253,965 Y687* probably null Het
Cyp2d34 G A 15: 82,620,776 R28W probably benign Het
Dbndd2 C A 2: 164,488,286 Q13K probably damaging Het
Dnah5 T A 15: 28,233,231 S245R probably benign Het
Dnajb5 A T 4: 42,956,990 T226S probably damaging Het
Dnmt1 T C 9: 20,927,134 E211G probably benign Het
Dnpep G A 1: 75,315,228 H214Y probably damaging Het
Drc3 G A 11: 60,370,580 V186M possibly damaging Het
Dvl3 A G 16: 20,527,039 D413G possibly damaging Het
Dyrk4 C T 6: 126,886,651 probably null Het
Edc4 T A 8: 105,885,874 D181E probably damaging Het
Enthd1 T C 15: 80,509,286 Y247C possibly damaging Het
Gm5622 A T 14: 51,654,915 R50S possibly damaging Het
Gpbp1 G A 13: 111,466,855 T20I probably damaging Het
Hnrnpdl A T 5: 100,036,551 Y276* probably null Het
Hsd3b7 A C 7: 127,801,232 E51A probably damaging Het
Ighv5-16 G T 12: 113,838,618 F87L probably damaging Het
Iqsec1 C T 6: 90,809,684 probably null Het
Klhl23 C A 2: 69,833,696 P463Q possibly damaging Het
Mast4 A T 13: 102,853,883 N43K probably damaging Het
Mme T G 3: 63,300,111 probably null Het
Mrps31 T G 8: 22,411,523 S20A probably benign Het
Myo5c A G 9: 75,249,809 R176G probably damaging Het
Naf1 T C 8: 66,877,695 V291A possibly damaging Het
Nbeal1 A T 1: 60,251,307 H1021L possibly damaging Het
Ncaph2 T C 15: 89,364,003 probably null Het
Neurod4 T G 10: 130,271,000 Y135S probably damaging Het
Nrp2 A T 1: 62,760,815 N396I probably damaging Het
Nvl T G 1: 181,134,995 T137P probably benign Het
Olfr483 A G 7: 108,104,128 D273G probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pcdhgc4 T A 18: 37,817,600 S690T possibly damaging Het
Pck1 A T 2: 173,154,012 D101V probably damaging Het
Pdilt T A 7: 119,495,042 N329Y probably damaging Het
Pfkl T A 10: 77,989,613 R648W probably damaging Het
Prtn3 T A 10: 79,880,548 I63N probably damaging Het
Psg22 C T 7: 18,722,798 A163V probably benign Het
Pten A G 19: 32,800,085 T160A possibly damaging Het
Retreg2 A G 1: 75,146,886 D449G probably damaging Het
Scn9a T C 2: 66,487,524 Y1531C probably benign Het
Sgk2 T A 2: 162,999,254 C195S probably damaging Het
Slc19a3 C T 1: 83,026,339 V14I probably benign Het
Snai2 A T 16: 14,708,243 R253* probably null Het
Speg G A 1: 75,414,387 V1512I probably damaging Het
Srsf1 G A 11: 88,049,599 probably benign Het
Tctn3 G T 19: 40,609,227 T190N probably benign Het
Tmprss11f T A 5: 86,539,699 I117L probably benign Het
Ttn G A 2: 76,852,069 R959* probably null Het
Vmn2r118 G T 17: 55,592,871 L678I possibly damaging Het
Vps13b T C 15: 35,668,738 S1594P probably damaging Het
Vps13d G T 4: 145,148,565 H1791N possibly damaging Het
Other mutations in Irgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Irgm2 APN 11 58220341 missense probably benign 0.00
IGL01933:Irgm2 APN 11 58219957 missense possibly damaging 0.95
IGL02115:Irgm2 APN 11 58220122 missense probably benign 0.21
IGL02398:Irgm2 APN 11 58219929 missense probably damaging 1.00
IGL02708:Irgm2 APN 11 58220524 missense probably benign 0.00
IGL02730:Irgm2 APN 11 58219990 missense probably benign 0.26
R0282:Irgm2 UTSW 11 58219519 missense probably benign 0.00
R1621:Irgm2 UTSW 11 58220538 missense probably benign
R1717:Irgm2 UTSW 11 58220635 missense probably damaging 1.00
R1980:Irgm2 UTSW 11 58220076 missense probably damaging 0.99
R1986:Irgm2 UTSW 11 58219558 missense probably benign 0.00
R2145:Irgm2 UTSW 11 58220529 missense possibly damaging 0.90
R2184:Irgm2 UTSW 11 58220428 missense probably benign 0.01
R2327:Irgm2 UTSW 11 58220392 missense probably damaging 1.00
R4041:Irgm2 UTSW 11 58220130 missense probably benign 0.00
R4231:Irgm2 UTSW 11 58219478 start gained probably benign
R5988:Irgm2 UTSW 11 58220187 missense probably benign 0.39
R6508:Irgm2 UTSW 11 58219501 missense probably benign
R6528:Irgm2 UTSW 11 58220052 missense probably benign 0.10
R6851:Irgm2 UTSW 11 58219815 missense possibly damaging 0.95
R7351:Irgm2 UTSW 11 58219605 missense possibly damaging 0.93
R7434:Irgm2 UTSW 11 58219465 missense probably benign 0.01
R8951:Irgm2 UTSW 11 58219582 missense possibly damaging 0.83
Z1186:Irgm2 UTSW 11 58219513 missense probably benign
Z1186:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1186:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1186:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1186:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1186:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1186:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1186:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1186:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Z1187:Irgm2 UTSW 11 58219513 missense probably benign
Z1187:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1187:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1187:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1187:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1187:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1187:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1187:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1187:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Z1188:Irgm2 UTSW 11 58219513 missense probably benign
Z1188:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1188:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1188:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1188:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1188:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1188:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1188:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1188:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Z1189:Irgm2 UTSW 11 58219513 missense probably benign
Z1189:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1189:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1189:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1189:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1189:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1189:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1189:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1189:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Z1190:Irgm2 UTSW 11 58219513 missense probably benign
Z1190:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1190:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1190:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1190:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1190:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1190:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1190:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1190:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Z1191:Irgm2 UTSW 11 58219513 missense probably benign
Z1191:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1191:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1191:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1191:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1191:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1191:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1191:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1191:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Z1192:Irgm2 UTSW 11 58219513 missense probably benign
Z1192:Irgm2 UTSW 11 58219563 missense probably benign 0.03
Z1192:Irgm2 UTSW 11 58219912 missense probably benign 0.01
Z1192:Irgm2 UTSW 11 58219954 missense probably benign 0.01
Z1192:Irgm2 UTSW 11 58220007 missense probably benign 0.44
Z1192:Irgm2 UTSW 11 58220098 missense probably benign 0.00
Z1192:Irgm2 UTSW 11 58220125 missense probably benign 0.00
Z1192:Irgm2 UTSW 11 58220412 missense possibly damaging 0.80
Z1192:Irgm2 UTSW 11 58220563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACATATCTCTCCACCTGGTTG -3'
(R):5'- AGTCGGCCTAGTAACCTCAAG -3'

Sequencing Primer
(F):5'- CCACCTGGTTGCTCTGGAAATG -3'
(R):5'- AGGAACTTGGACCCCATGG -3'
Posted On2017-10-10