Incidental Mutation 'R4333:Ddx18'
ID500582
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R4333 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121564602 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 125 (D125E)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably benign
Transcript: ENSMUST00000001724
AA Change: D125E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: D125E

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131471
Predicted Effect probably benign
Transcript: ENSMUST00000134417
SMART Domains Protein: ENSMUSP00000114149
Gene: ENSMUSG00000001674

DomainStartEndE-ValueType
Blast:DEXDc 2 47 2e-22 BLAST
HELICc 65 146 2.84e-26 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,370 L710P probably damaging Het
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Cadps C T 14: 12,467,031 R967H probably damaging Het
Cwh43 A G 5: 73,441,379 D647G probably damaging Het
Dab2ip T A 2: 35,661,620 *164R probably null Het
Fbxw7 T C 3: 84,972,495 C375R probably damaging Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Lamp3 T C 16: 19,673,436 I353V probably benign Het
Med13 A G 11: 86,288,183 F1429S probably benign Het
Mybl1 T C 1: 9,672,298 K621E probably damaging Het
Myo19 G A 11: 84,908,288 A816T probably benign Het
Olfr573-ps1 A T 7: 102,941,969 L203I possibly damaging Het
Olfr934 A G 9: 38,982,588 I152T possibly damaging Het
Rnf2 T C 1: 151,473,076 T98A possibly damaging Het
Samm50 A G 15: 84,202,830 K280R probably benign Het
Satb2 T C 1: 56,845,586 N511S probably damaging Het
Tbc1d19 A G 5: 53,872,277 T327A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r7 T C 3: 64,690,778 N786S probably damaging Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTTTAGTCATGCAGAGAAATGGTG -3'
(R):5'- ACAGGGGTGATCCTTTTCTAATCTG -3'

Sequencing Primer
(F):5'- GTGACATTTCTAAGACAAGACACCTG -3'
(R):5'- GGTGATCCTTTTCTAATCTGGAATAC -3'
Posted On2017-12-01