Incidental Mutation 'R0550:Ddx18'
ID45057
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission 038742-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0550 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121555375 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 561 (K561E)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably benign
Transcript: ENSMUST00000001724
AA Change: K561E

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: K561E

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134417
SMART Domains Protein: ENSMUSP00000114149
Gene: ENSMUSG00000001674

DomainStartEndE-ValueType
Blast:DEXDc 2 47 2e-22 BLAST
HELICc 65 146 2.84e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148809
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCTCAATTGTAGCACAACGTC -3'
(R):5'- TGTTCTCAGAACCAGCACTGTCCC -3'

Sequencing Primer
(F):5'- TTGTAGCACAACGTCACAAAGG -3'
(R):5'- GATATCCAGTCTCAGGTACGC -3'
Posted On2013-06-11