Incidental Mutation 'R5825:A1bg'
ID501607
Institutional Source Beutler Lab
Gene Symbol A1bg
Ensembl Gene ENSMUSG00000022347
Gene Namealpha-1-B glycoprotein
SynonymsC44
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location60896859-60923012 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 60920127 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 217 (Y217*)
Ref Sequence ENSEMBL: ENSMUSP00000094151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096418] [ENSMUST00000228632]
Predicted Effect probably null
Transcript: ENSMUST00000096418
AA Change: Y217*
SMART Domains Protein: ENSMUSP00000094151
Gene: ENSMUSG00000022347
AA Change: Y217*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG_like 34 109 1.09e2 SMART
Blast:IG_like 137 215 5e-15 BLAST
Pfam:Ig_2 223 314 8.8e-11 PFAM
IG 328 415 1.32e-3 SMART
IG_like 426 511 9.21e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228929
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Jcad T A 18: 4,674,896 V886E probably benign Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in A1bg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:A1bg APN 15 60921253 missense probably damaging 0.98
IGL01622:A1bg APN 15 60917893 missense possibly damaging 0.66
IGL01623:A1bg APN 15 60917893 missense possibly damaging 0.66
IGL03131:A1bg APN 15 60919756 missense probably damaging 1.00
IGL03162:A1bg APN 15 60919732 missense probably damaging 0.99
IGL03356:A1bg APN 15 60919888 missense probably benign 0.00
R0009:A1bg UTSW 15 60919633 unclassified probably benign
R0009:A1bg UTSW 15 60919633 unclassified probably benign
R0014:A1bg UTSW 15 60919732 missense probably damaging 0.99
R1084:A1bg UTSW 15 60918155 unclassified probably benign
R1199:A1bg UTSW 15 60919635 critical splice donor site probably null
R4212:A1bg UTSW 15 60919736 missense possibly damaging 0.91
R4543:A1bg UTSW 15 60917900 missense probably damaging 1.00
R4835:A1bg UTSW 15 60920251 missense probably benign 0.00
R5404:A1bg UTSW 15 60919696 missense probably benign 0.02
R5553:A1bg UTSW 15 60920841 missense probably damaging 0.98
R5580:A1bg UTSW 15 60919032 missense probably benign 0.09
R5583:A1bg UTSW 15 60921234 missense probably damaging 1.00
R5937:A1bg UTSW 15 60919646 missense probably benign 0.22
R6021:A1bg UTSW 15 60919864 missense possibly damaging 0.84
R6193:A1bg UTSW 15 60920780 missense probably benign 0.00
R6565:A1bg UTSW 15 60920810 missense probably damaging 1.00
R6870:A1bg UTSW 15 60919715 missense probably damaging 1.00
R6939:A1bg UTSW 15 60920395 missense probably damaging 0.98
R8115:A1bg UTSW 15 60920147 missense probably benign 0.18
R8213:A1bg UTSW 15 60919756 missense probably damaging 1.00
Z1177:A1bg UTSW 15 60918074 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCCCATCAAACACAGAGTGGG -3'
(R):5'- ATGTGCCAGGTTGCAATGC -3'

Sequencing Primer
(F):5'- CCTGTGAGGCTGCAAGC -3'
(R):5'- AATGCGGGGTGTGACCTAC -3'
Posted On2017-12-01