Incidental Mutation 'R6194:Prodh'
ID502810
Institutional Source Beutler Lab
Gene Symbol Prodh
Ensembl Gene ENSMUSG00000003526
Gene Nameproline dehydrogenase
SynonymsPro1, Ym24d07, Pro-1
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location18060357-18090203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18072517 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 515 (H515Q)
Ref Sequence ENSEMBL: ENSMUSP00000003620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003620] [ENSMUST00000066027] [ENSMUST00000076757] [ENSMUST00000136776] [ENSMUST00000139861] [ENSMUST00000143343] [ENSMUST00000151266] [ENSMUST00000153123] [ENSMUST00000155387] [ENSMUST00000232554]
Predicted Effect probably benign
Transcript: ENSMUST00000003620
AA Change: H515Q

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003620
Gene: ENSMUSG00000003526
AA Change: H515Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Pfam:Pro_dh 119 578 7.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066027
SMART Domains Protein: ENSMUSP00000067682
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 1 198 4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076757
SMART Domains Protein: ENSMUSP00000076044
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123969
Predicted Effect unknown
Transcript: ENSMUST00000126087
AA Change: H185Q
SMART Domains Protein: ENSMUSP00000121736
Gene: ENSMUSG00000003526
AA Change: H185Q

DomainStartEndE-ValueType
Pfam:Pro_dh 25 244 2.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136776
AA Change: H413Q

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117597
Gene: ENSMUSG00000003526
AA Change: H413Q

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
Pfam:Pro_dh 159 479 1.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139861
SMART Domains Protein: ENSMUSP00000123223
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141635
Predicted Effect probably benign
Transcript: ENSMUST00000143343
SMART Domains Protein: ENSMUSP00000123029
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148514
Predicted Effect probably benign
Transcript: ENSMUST00000151266
SMART Domains Protein: ENSMUSP00000122572
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 1 195 3.1e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153123
SMART Domains Protein: ENSMUSP00000118954
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 3 163 9.6e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155387
SMART Domains Protein: ENSMUSP00000123053
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 41 1.6e-10 PFAM
Pfam:DGCR6 59 230 9.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232384
Predicted Effect probably benign
Transcript: ENSMUST00000232554
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous null mutation exhibit a slight reduction in male body weight, hyperprolinemia, increased startle reflex, and regionally altered brain levels of proline, glutamate, gamma-aminobutyric acid, and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Prodh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Prodh APN 16 18076344 missense probably damaging 0.99
IGL02063:Prodh APN 16 18079185 critical splice donor site probably null
IGL02525:Prodh APN 16 18072468 nonsense probably null
R0147:Prodh UTSW 16 18077813 missense probably damaging 1.00
R0148:Prodh UTSW 16 18077813 missense probably damaging 1.00
R1643:Prodh UTSW 16 18081069 missense probably benign 0.23
R1913:Prodh UTSW 16 18081027 missense probably damaging 1.00
R4190:Prodh UTSW 16 18073640 missense probably benign 0.27
R4191:Prodh UTSW 16 18073640 missense probably benign 0.27
R4193:Prodh UTSW 16 18073640 missense probably benign 0.27
R4204:Prodh UTSW 16 18072318 missense probably damaging 1.00
R5074:Prodh UTSW 16 18077789 critical splice donor site probably null
R6274:Prodh UTSW 16 18081058 missense possibly damaging 0.91
R6376:Prodh UTSW 16 18079985 missense probably benign
R6744:Prodh UTSW 16 18079200 missense probably benign 0.43
Z1177:Prodh UTSW 16 18089027 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCACATACTTGTACACAGGAAAGC -3'
(R):5'- GGACAAGTTTTCTGCCCTGG -3'

Sequencing Primer
(F):5'- CCCAGGAAAATCCAGTTCA -3'
(R):5'- GTTGTACTGTGAAGACCTAGATAGC -3'
Posted On2018-02-27