Mutagenetix > Incidental Mutation

Incidental Mutation 'R6237:Srbd1'

505024

Institutional Source

Beutler Lab

Gene Symbol

Srbd1

Ensembl Gene

ENSMUSG00000024135

Gene Name

S1 RNA binding domain 1

Synonyms

MMRRC Submission

044362-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R6237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85984665-86145175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85985295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 949 (R949G)

Ref Sequence

ENSEMBL: ENSMUSP00000092810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095187]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000095187
AA Change: R949G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: R949G

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	104	128	N/A	INTRINSIC
Pfam:Tex_N	213	403	2.8e-43	PFAM
YqgFc	532	631	4.1e-32	SMART
Pfam:HHH_7	668	764	1.6e-6	PFAM
Pfam:HHH_3	698	762	4.2e-25	PFAM
S1	903	978	7e-15	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	G	A	8: 119,615,763	R380H	probably damaging	Het
Akr1c12	C	A	13: 4,275,768	D109Y	possibly damaging	Het
Cacna1s	A	T	1: 136,105,844	M1020L	possibly damaging	Het
Cbx8	C	A	11: 119,040,387	R25L	possibly damaging	Het
Ccdc87	A	G	19: 4,841,379	Y633C	probably benign	Het
Col4a4	C	T	1: 82,507,031	S505N	unknown	Het
Cr2	T	A	1: 195,157,502	H539L	probably damaging	Het
Cyp2b9	T	A	7: 26,173,574	D47E	probably benign	Het
Dnah3	A	C	7: 120,009,384	M1784R	probably damaging	Het
Dnah8	T	A	17: 30,747,854	L2520*	probably null	Het
E2f2	A	G	4: 136,178,485	E103G	possibly damaging	Het
Eef1akmt3	T	A	10: 127,033,008	H199L	possibly damaging	Het
Faxc	A	T	4: 21,993,376	N340I	possibly damaging	Het
Fer1l6	A	T	15: 58,625,177	R1199*	probably null	Het
Fer1l6	A	G	15: 58,638,006	D1439G	probably damaging	Het
Galnt5	G	T	2: 58,035,249	W847C	probably damaging	Het
Gbp2	G	A	3: 142,632,032	S303N	probably benign	Het
Glipr1l1	A	T	10: 112,060,427	K40*	probably null	Het
Gm4353	A	C	7: 116,083,899	L149R	possibly damaging	Het
Grk5	A	G	19: 61,089,942	D479G	probably damaging	Het
Gzmc	T	A	14: 56,234,029		probably null	Het
Hace1	T	C	10: 45,648,890	Y251H	probably benign	Het
Hhla1	G	T	15: 65,941,797	P229T	probably damaging	Het
Hspa1l	C	T	17: 34,977,452	Q156*	probably null	Het
Igkv4-78	A	T	6: 69,059,699	Y117N	probably benign	Het
Ikzf3	C	A	11: 98,467,053	R486L	probably damaging	Het
Itpr1	C	T	6: 108,378,203	T485M	possibly damaging	Het
Kcnab3	T	C	11: 69,328,575	Y131H	probably benign	Het
Kcnu1	C	T	8: 25,932,334	P209L	probably benign	Het
Klk8	T	A	7: 43,798,670	C39*	probably null	Het
Mbtps1	A	G	8: 119,528,961	L519P	probably damaging	Het
Mgat4a	A	G	1: 37,456,592	I287T	probably damaging	Het
Mindy2	T	C	9: 70,605,198	E590G	possibly damaging	Het
Mllt11	G	T	3: 95,220,291	T56K	probably benign	Het
Myo5b	G	A	18: 74,742,178	R1551H	probably damaging	Het
Nmrk2	T	C	10: 81,200,962	T16A	possibly damaging	Het
Olfr324	T	A	11: 58,598,005	F203Y	probably damaging	Het
Olfr862	G	T	9: 19,884,069	P79T	probably damaging	Het
Osbpl9	T	C	4: 109,156,702	D65G	probably damaging	Het
Phf2	T	A	13: 48,803,655	K1079*	probably null	Het
Plcb1	A	G	2: 135,370,566	S1026G	possibly damaging	Het
Pnrc2	A	T	4: 135,872,086	H117Q	probably benign	Het
Ppfia2	A	T	10: 106,913,594	I1114F	probably damaging	Het
Rpl12	G	A	2: 32,962,988	E72K	probably benign	Het
Sbf1	C	T	15: 89,293,476	R1642H	probably benign	Het
Sephs2	G	A	7: 127,273,946		probably benign	Het
Slc35c2	A	T	2: 165,280,697	L194H	probably damaging	Het
Slfn4	T	A	11: 83,189,112	Y150N	probably damaging	Het
Urah	T	A	7: 140,835,705	S28T	probably damaging	Het
Wdr62	A	G	7: 30,242,435	S649P	probably damaging	Het
Wnk1	C	A	6: 119,952,767	G1263V	probably damaging	Het
Zbtb4	C	A	11: 69,778,243	D114E	possibly damaging	Het

Other mutations in Srbd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Srbd1	APN	17	86115209	missense	probably damaging	1.00
IGL00988:Srbd1	APN	17	86130270	missense	probably damaging	0.96
IGL01111:Srbd1	APN	17	86098533	missense	probably benign	0.15
IGL02186:Srbd1	APN	17	86109231	missense	probably benign
IGL02233:Srbd1	APN	17	86098622	splice site	probably null
IGL02307:Srbd1	APN	17	86126188	missense	probably damaging	1.00
IGL02392:Srbd1	APN	17	85988373	missense	probably benign	0.34
IGL02831:Srbd1	APN	17	86003871	missense	probably damaging	1.00
IGL03299:Srbd1	APN	17	86120659	missense	possibly damaging	0.95
PIT4494001:Srbd1	UTSW	17	86142359	critical splice donor site	probably null
PIT4677001:Srbd1	UTSW	17	86115212	nonsense	probably null
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0233:Srbd1	UTSW	17	86057745	missense	probably damaging	1.00
R0464:Srbd1	UTSW	17	86120002	missense	probably damaging	1.00
R0692:Srbd1	UTSW	17	86136460	missense	probably benign	0.25
R0771:Srbd1	UTSW	17	86130254	missense	probably benign	0.09
R1074:Srbd1	UTSW	17	86003952	missense	probably damaging	1.00
R1173:Srbd1	UTSW	17	86098512	missense	probably null	1.00
R1446:Srbd1	UTSW	17	86139152	missense	probably benign	0.44
R1587:Srbd1	UTSW	17	85985437	missense	probably damaging	1.00
R1780:Srbd1	UTSW	17	86057685	missense	probably damaging	1.00
R1865:Srbd1	UTSW	17	86115304	splice site	probably benign
R1933:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R1934:Srbd1	UTSW	17	86102893	missense	probably damaging	1.00
R2002:Srbd1	UTSW	17	86142400	missense	probably benign
R2228:Srbd1	UTSW	17	85985223	missense	probably damaging	1.00
R3160:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3162:Srbd1	UTSW	17	86130215	missense	probably benign	0.03
R3439:Srbd1	UTSW	17	86057759	missense	probably benign	0.01
R3611:Srbd1	UTSW	17	86102927	missense	probably benign	0.03
R4255:Srbd1	UTSW	17	86102922	missense	possibly damaging	0.80
R4300:Srbd1	UTSW	17	85985204	missense	probably damaging	0.98
R4319:Srbd1	UTSW	17	86051150	missense	probably damaging	1.00
R4619:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4620:Srbd1	UTSW	17	86109265	missense	probably benign	0.30
R4629:Srbd1	UTSW	17	86120672	missense	probably damaging	0.99
R5379:Srbd1	UTSW	17	86001536	missense	possibly damaging	0.88
R5469:Srbd1	UTSW	17	86119942	missense	possibly damaging	0.77
R5587:Srbd1	UTSW	17	86127801	missense	probably damaging	0.99
R5726:Srbd1	UTSW	17	86120729	missense	possibly damaging	0.89
R6166:Srbd1	UTSW	17	86099268	missense	probably damaging	1.00
R6696:Srbd1	UTSW	17	86139191	missense	possibly damaging	0.46
R6971:Srbd1	UTSW	17	86099290	missense	possibly damaging	0.79
R6986:Srbd1	UTSW	17	85985222	missense	probably damaging	1.00
R7018:Srbd1	UTSW	17	86136415	missense	possibly damaging	0.93
R7082:Srbd1	UTSW	17	86057732	missense	probably damaging	1.00
R7209:Srbd1	UTSW	17	86001520	missense	probably damaging	1.00
R7340:Srbd1	UTSW	17	86136354	missense	probably benign	0.02
R7417:Srbd1	UTSW	17	86136321	missense	probably benign
R7467:Srbd1	UTSW	17	86099274	missense	probably damaging	0.96
R7833:Srbd1	UTSW	17	85985454	missense	possibly damaging	0.63
R8720:Srbd1	UTSW	17	86051143	missense	probably damaging	1.00
R8839:Srbd1	UTSW	17	85988421	missense	probably benign
R8899:Srbd1	UTSW	17	85985457	missense
R8905:Srbd1	UTSW	17	86001462	missense	probably benign	0.00
R9051:Srbd1	UTSW	17	86120687	missense	possibly damaging	0.70
R9402:Srbd1	UTSW	17	86099277	missense	probably benign	0.26
R9701:Srbd1	UTSW	17	86126131	missense	probably damaging	1.00
R9729:Srbd1	UTSW	17	86130122	missense	probably benign
R9733:Srbd1	UTSW	17	86115283	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGGTTCCATGAGCTCTGGC -3'
(R):5'- GGCTTCTTGACTACACTAGTGTTTC -3'

Sequencing Primer
(F):5'- CTCGTCCTTGTCAGGCTGTAGAAG -3'
(R):5'- CCTCACAGATTTTGATAAGCCTGAC -3'

Posted On

2018-02-28