Incidental Mutation 'R6237:Dnah3'
ID504996
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission 044362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6237 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120009384 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1784 (M1784R)
Ref Sequence ENSEMBL: ENSMUSP00000146895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably damaging
Transcript: ENSMUST00000046993
AA Change: M1795R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: M1795R

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209154
AA Change: M1784R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Meta Mutation Damage Score 0.3678 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 G A 8: 119,615,763 R380H probably damaging Het
Akr1c12 C A 13: 4,275,768 D109Y possibly damaging Het
Cacna1s A T 1: 136,105,844 M1020L possibly damaging Het
Cbx8 C A 11: 119,040,387 R25L possibly damaging Het
Ccdc87 A G 19: 4,841,379 Y633C probably benign Het
Col4a4 C T 1: 82,507,031 S505N unknown Het
Cr2 T A 1: 195,157,502 H539L probably damaging Het
Cyp2b9 T A 7: 26,173,574 D47E probably benign Het
Dnah8 T A 17: 30,747,854 L2520* probably null Het
E2f2 A G 4: 136,178,485 E103G possibly damaging Het
Eef1akmt3 T A 10: 127,033,008 H199L possibly damaging Het
Faxc A T 4: 21,993,376 N340I possibly damaging Het
Fer1l6 A T 15: 58,625,177 R1199* probably null Het
Fer1l6 A G 15: 58,638,006 D1439G probably damaging Het
Galnt5 G T 2: 58,035,249 W847C probably damaging Het
Gbp2 G A 3: 142,632,032 S303N probably benign Het
Glipr1l1 A T 10: 112,060,427 K40* probably null Het
Gm4353 A C 7: 116,083,899 L149R possibly damaging Het
Grk5 A G 19: 61,089,942 D479G probably damaging Het
Gzmc T A 14: 56,234,029 probably null Het
Hace1 T C 10: 45,648,890 Y251H probably benign Het
Hhla1 G T 15: 65,941,797 P229T probably damaging Het
Hspa1l C T 17: 34,977,452 Q156* probably null Het
Igkv4-78 A T 6: 69,059,699 Y117N probably benign Het
Ikzf3 C A 11: 98,467,053 R486L probably damaging Het
Itpr1 C T 6: 108,378,203 T485M possibly damaging Het
Kcnab3 T C 11: 69,328,575 Y131H probably benign Het
Kcnu1 C T 8: 25,932,334 P209L probably benign Het
Klk8 T A 7: 43,798,670 C39* probably null Het
Mbtps1 A G 8: 119,528,961 L519P probably damaging Het
Mgat4a A G 1: 37,456,592 I287T probably damaging Het
Mindy2 T C 9: 70,605,198 E590G possibly damaging Het
Mllt11 G T 3: 95,220,291 T56K probably benign Het
Myo5b G A 18: 74,742,178 R1551H probably damaging Het
Nmrk2 T C 10: 81,200,962 T16A possibly damaging Het
Olfr324 T A 11: 58,598,005 F203Y probably damaging Het
Olfr862 G T 9: 19,884,069 P79T probably damaging Het
Osbpl9 T C 4: 109,156,702 D65G probably damaging Het
Phf2 T A 13: 48,803,655 K1079* probably null Het
Plcb1 A G 2: 135,370,566 S1026G possibly damaging Het
Pnrc2 A T 4: 135,872,086 H117Q probably benign Het
Ppfia2 A T 10: 106,913,594 I1114F probably damaging Het
Rpl12 G A 2: 32,962,988 E72K probably benign Het
Sbf1 C T 15: 89,293,476 R1642H probably benign Het
Sephs2 G A 7: 127,273,946 probably benign Het
Slc35c2 A T 2: 165,280,697 L194H probably damaging Het
Slfn4 T A 11: 83,189,112 Y150N probably damaging Het
Srbd1 T C 17: 85,985,295 R949G probably damaging Het
Urah T A 7: 140,835,705 S28T probably damaging Het
Wdr62 A G 7: 30,242,435 S649P probably damaging Het
Wnk1 C A 6: 119,952,767 G1263V probably damaging Het
Zbtb4 C A 11: 69,778,243 D114E possibly damaging Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 splice site probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 splice site probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
R7431:Dnah3 UTSW 7 120051744 missense probably damaging 1.00
R7499:Dnah3 UTSW 7 120060912 missense probably damaging 0.99
R7515:Dnah3 UTSW 7 120073592 missense probably benign 0.21
R7564:Dnah3 UTSW 7 119971594 missense probably benign
R7618:Dnah3 UTSW 7 119978378 missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119967434 missense
R7728:Dnah3 UTSW 7 119938828 missense probably damaging 1.00
R7757:Dnah3 UTSW 7 120071570 missense probably benign
R7757:Dnah3 UTSW 7 119971215 splice site probably null
R7774:Dnah3 UTSW 7 119951752 nonsense probably null
R7804:Dnah3 UTSW 7 119952618 missense probably damaging 1.00
R7804:Dnah3 UTSW 7 120011012 missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119951704 missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119967552 missense
R7903:Dnah3 UTSW 7 120042128 missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R7989:Dnah3 UTSW 7 120077789 missense probably benign
R8142:Dnah3 UTSW 7 120060966 missense probably benign 0.00
R8164:Dnah3 UTSW 7 119967614 missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119926413 missense probably benign 0.01
R8313:Dnah3 UTSW 7 119951152 missense probably benign 0.38
R8338:Dnah3 UTSW 7 120071881 missense probably benign 0.01
R8355:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119952505 missense probably damaging 1.00
R8411:Dnah3 UTSW 7 120011030 missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119967803 missense
Z1177:Dnah3 UTSW 7 119967901 missense probably damaging 0.99
Z1177:Dnah3 UTSW 7 120007862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATTCTTCTCCTCCCTGTCC -3'
(R):5'- TGAGGCCAGATACTCTTTCTCT -3'

Sequencing Primer
(F):5'- CCCTGTCCTTCCCCCAC -3'
(R):5'- CCTGACACATAGTGGGTGCTTAAC -3'
Posted On2018-02-28