Incidental Mutation 'R6242:Akr1c6'
ID505320
Institutional Source Beutler Lab
Gene Symbol Akr1c6
Ensembl Gene ENSMUSG00000021210
Gene Namealdo-keto reductase family 1, member C6
Synonyms3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Hsd17b5, Akr1c1
MMRRC Submission
Accession Numbers

Genbank: NM_030611; MGI: 1933427

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6242 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location4434306-4457877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4436362 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 56 (Q56R)
Ref Sequence ENSEMBL: ENSMUSP00000021630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021630] [ENSMUST00000156277] [ENSMUST00000220941]
Predicted Effect probably benign
Transcript: ENSMUST00000021630
AA Change: Q56R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021630
Gene: ENSMUSG00000021210
AA Change: Q56R

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128695
Predicted Effect probably benign
Transcript: ENSMUST00000156277
AA Change: Q3R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000117624
Gene: ENSMUSG00000021210
AA Change: Q3R

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 173 3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220941
AA Change: Q56R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,763,915 E148K probably benign Het
1700016K19Rik T C 11: 76,000,155 S32P probably damaging Het
4933425L06Rik T A 13: 105,109,540 V203E probably benign Het
Adcy6 G T 15: 98,604,015 C239* probably null Het
Apaf1 T A 10: 91,062,163 D244V probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef11 C A 3: 87,728,078 A898E probably benign Het
Asxl3 A T 18: 22,522,376 N1148Y probably damaging Het
Atf6 T A 1: 170,793,976 Q492L possibly damaging Het
Atrnl1 G T 19: 57,642,478 V226F probably benign Het
Cntnap1 A T 11: 101,182,538 Y615F probably damaging Het
Crybg3 T C 16: 59,555,690 T1734A probably benign Het
Ctdp1 A C 18: 80,459,212 V161G probably damaging Het
Cyp4a30b T A 4: 115,454,390 V85E possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha6 A T 16: 59,682,662 W961R probably damaging Het
Fam114a1 A G 5: 65,031,352 E475G probably damaging Het
Fam186a A G 15: 99,939,907 Y2819H unknown Het
Fancm A T 12: 65,116,442 Q1460L probably benign Het
Fancm C A 12: 65,116,449 N1462K probably benign Het
Fgf14 T C 14: 124,676,528 K64E probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Garem1 C G 18: 21,129,172 V862L possibly damaging Het
Grin3b G A 10: 79,976,179 G814R probably damaging Het
Hacd4 A G 4: 88,414,287 S226P probably benign Het
Htt A G 5: 34,846,012 Y1277C probably damaging Het
Igkv1-131 T A 6: 67,766,078 D107V probably damaging Het
Iqcc T C 4: 129,616,846 D292G probably damaging Het
Krtap13 C T 16: 88,751,496 V35I probably damaging Het
Lrrc59 G T 11: 94,634,983 L132F possibly damaging Het
Mcub T C 3: 129,915,795 S290G probably benign Het
Mettl4 A G 17: 94,735,374 W345R probably damaging Het
Msgn1 G A 12: 11,208,525 R142W probably damaging Het
Myo5c A G 9: 75,273,611 I761V probably benign Het
Neb T A 2: 52,176,812 K5879M probably damaging Het
Nkd2 C T 13: 73,822,786 V226M probably damaging Het
Olfr1459 T A 19: 13,146,086 H191L probably benign Het
Olfr645 T G 7: 104,084,564 H172P possibly damaging Het
Parp4 T A 14: 56,595,399 L393* probably null Het
Pcdhgb6 G A 18: 37,743,555 V439I probably benign Het
Pde1a T A 2: 80,128,792 T15S probably benign Het
Pgr T A 9: 8,900,979 I171N probably benign Het
Podxl T A 6: 31,526,245 D296V probably benign Het
Polr3e A T 7: 120,940,467 E479V possibly damaging Het
Prdm10 A T 9: 31,341,252 H427L possibly damaging Het
Prl5a1 A T 13: 28,142,555 K5* probably null Het
Prph A G 15: 99,057,123 S325G probably damaging Het
Rabl2 C A 15: 89,584,352 W49L probably benign Het
Rbbp8nl T A 2: 180,280,974 I209F probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn7a T C 2: 66,700,766 D589G probably benign Het
Sdr42e1 A T 8: 117,663,197 L235Q possibly damaging Het
Serpina3a T C 12: 104,116,001 M11T probably benign Het
Slc6a4 A T 11: 77,018,358 K399* probably null Het
Slco4c1 T A 1: 96,839,283 T337S probably damaging Het
Spc25 A T 2: 69,197,211 F112L probably damaging Het
Swt1 A G 1: 151,407,614 S331P probably benign Het
Tab1 A T 15: 80,155,770 K264* probably null Het
Tagln3 T A 16: 45,724,338 probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbck A G 3: 132,694,428 D80G probably benign Het
Tcim A T 8: 24,438,895 M1K probably null Het
Thap2 A G 10: 115,372,926 S37P unknown Het
Tjp2 A T 19: 24,099,603 probably null Het
Tln1 G A 4: 43,533,145 S2390L probably damaging Het
Trpm5 T G 7: 143,073,182 I1101L probably benign Het
Ttc3 T G 16: 94,442,695 M831R probably benign Het
Tulp3 A G 6: 128,323,087 C459R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Unc13b A T 4: 43,165,800 T195S possibly damaging Het
Urgcp A G 11: 5,716,691 L549P probably benign Het
Usp10 G T 8: 119,941,838 A293S probably benign Het
Vmn2r23 A G 6: 123,704,400 E89G possibly damaging Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Wif1 T C 10: 121,034,461 I40T possibly damaging Het
Zmynd8 G A 2: 165,898,947 R6C possibly damaging Het
Other mutations in Akr1c6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Akr1c6 APN 13 4448978 splice site probably benign
IGL01838:Akr1c6 APN 13 4449036 missense probably benign 0.44
IGL02318:Akr1c6 APN 13 4438497 missense probably benign 0.05
IGL02986:Akr1c6 APN 13 4436415 missense probably benign 0.42
IGL03168:Akr1c6 APN 13 4436281 missense probably benign 0.04
IGL03190:Akr1c6 APN 13 4446413 missense possibly damaging 0.49
IGL03258:Akr1c6 APN 13 4436409 missense probably damaging 1.00
R0940:Akr1c6 UTSW 13 4436373 missense probably benign 0.42
R1442:Akr1c6 UTSW 13 4457160 missense probably damaging 1.00
R1624:Akr1c6 UTSW 13 4446364 missense probably benign
R1937:Akr1c6 UTSW 13 4446384 missense probably benign 0.01
R2392:Akr1c6 UTSW 13 4434478 splice site probably null
R2398:Akr1c6 UTSW 13 4449036 missense probably benign 0.44
R4655:Akr1c6 UTSW 13 4449429 missense probably damaging 0.98
R4761:Akr1c6 UTSW 13 4447011 missense probably benign 0.01
R4913:Akr1c6 UTSW 13 4454525 missense probably benign 0.18
R4923:Akr1c6 UTSW 13 4454495 missense probably damaging 1.00
R4953:Akr1c6 UTSW 13 4438609 splice site probably null
R5255:Akr1c6 UTSW 13 4447019 missense probably benign 0.20
R5452:Akr1c6 UTSW 13 4454545 missense probably benign 0.00
R5660:Akr1c6 UTSW 13 4449054 missense probably benign 0.13
R6323:Akr1c6 UTSW 13 4447018 missense possibly damaging 0.91
R6599:Akr1c6 UTSW 13 4449319 unclassified probably null
R6847:Akr1c6 UTSW 13 4438498 nonsense probably null
R6989:Akr1c6 UTSW 13 4449046 missense probably damaging 1.00
R7003:Akr1c6 UTSW 13 4454515 missense probably benign 0.14
R7251:Akr1c6 UTSW 13 4447020 missense probably damaging 1.00
R7310:Akr1c6 UTSW 13 4436355 missense probably benign
X0062:Akr1c6 UTSW 13 4438535 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GACAAACTTGGTTGCATTCTTCAC -3'
(R):5'- AGTTCACCAACATTCATTGACC -3'

Sequencing Primer
(F):5'- GGTTGCATTCTTCACTGCAAATG -3'
(R):5'- GTTCACCAACATTCATTGACCTAATC -3'
Posted On2018-02-28