Mutagenetix > Incidental Mutation

Incidental Mutation 'R6270:Sf3b3'

507276

Institutional Source

Beutler Lab

Gene Symbol

Sf3b3

Ensembl Gene

ENSMUSG00000033732

Gene Name

splicing factor 3b, subunit 3

Synonyms

5730409A01Rik, 1810061H24Rik, D8Ertd633e, SAP130, RSE1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R6270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110810239-110846787 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110841820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 174 (D174G)

Ref Sequence

ENSEMBL: ENSMUSP00000045073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042012] [ENSMUST00000165867]

AlphaFold

Q921M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000042012
AA Change: D174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045073
Gene: ENSMUSG00000033732
AA Change: D174G

Domain	Start	End	E-Value	Type
Blast:SH3	17	70	5e-13	BLAST
Pfam:MMS1_N	76	592	3.2e-185	PFAM
low complexity region	716	728	N/A	INTRINSIC
Pfam:CPSF_A	863	1184	4.3e-104	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116746

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116868

Predicted Effect

probably benign
Transcript: ENSMUST00000165867

SMART Domains

Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753

Domain	Start	End	E-Value	Type
Blast:Cog4	8	105	6e-54	BLAST
Cog4	115	425	1.81e-140	SMART
PDB:3HR0\|B	452	712	1e-174	PDB
Blast:DIL	621	702	6e-38	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212515

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212843

Meta Mutation Damage Score

0.7383

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030462N17Rik	T	C	18: 77,674,421	D65G	probably damaging	Het
Acsl6	A	G	11: 54,352,107	E648G	probably benign	Het
Ak7	A	G	12: 105,768,701	H642R	probably benign	Het
Akap11	T	C	14: 78,518,799	E53G	probably damaging	Het
Ddr2	T	G	1: 169,988,540	T533P	probably benign	Het
Dhx40	A	G	11: 86,799,605	S197P	possibly damaging	Het
Dolpp1	C	A	2: 30,392,269		probably benign	Het
Eng	A	G	2: 32,673,643	D347G	probably benign	Het
Esrra	C	T	19: 6,914,120		probably null	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fap	T	C	2: 62,547,788	I159V	probably damaging	Het
Fn1	C	T	1: 71,637,275	C599Y	probably damaging	Het
Fnbp4	T	C	2: 90,757,463	V395A	probably damaging	Het
Foxn3	T	C	12: 99,388,417	R163G	probably damaging	Het
Gphn	T	G	12: 78,522,950	L306R	probably benign	Het
Gse1	T	C	8: 120,569,163		probably benign	Het
Habp2	A	G	19: 56,306,863	D62G	possibly damaging	Het
Hdac7	AGGG	AGGGG	15: 97,808,495		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Kit	A	G	5: 75,609,509	T194A	probably benign	Het
Krt16	C	A	11: 100,247,203	A316S	possibly damaging	Het
Krt7	A	G	15: 101,419,558	D244G	probably damaging	Het
Lhfpl3	T	A	5: 23,273,351	Y77*	probably null	Het
Lrrc18	A	T	14: 33,009,121	M206L	probably benign	Het
Magel2	C	A	7: 62,380,658	C1103*	probably null	Het
Mcf2l	T	C	8: 13,018,701	V1058A	probably damaging	Het
Nbas	G	A	12: 13,324,293	A541T	probably damaging	Het
Nrap	C	T	19: 56,320,198	M1485I	probably benign	Het
Nudt18	T	C	14: 70,579,390	Y145H	probably benign	Het
Olfr175-ps1	A	T	16: 58,824,419	C97S	probably damaging	Het
Olfr583	T	C	7: 103,051,331	L11P	probably benign	Het
Olfr623	T	C	7: 103,660,413	Y279C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb12	A	T	18: 37,436,785	Q328L	possibly damaging	Het
Pde6c	T	C	19: 38,158,436	W431R	probably damaging	Het
Pga5	T	C	19: 10,674,861	E139G	probably benign	Het
Pkdrej	G	T	15: 85,821,105	S210*	probably null	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Sema3d	A	T	5: 12,448,107	M27L	probably benign	Het
Serinc5	T	C	13: 92,688,662	S200P	probably damaging	Het
Sult1b1	A	T	5: 87,517,554		probably null	Het
Tcaf3	T	C	6: 42,593,791	I342M	probably benign	Het
Tenm3	G	A	8: 48,367,394	T136M	probably damaging	Het
Tet3	T	C	6: 83,375,791	T1008A	possibly damaging	Het
Tgif1	T	C	17: 70,844,866		probably null	Het
Trav15-2-dv6-2	A	G	14: 53,649,866	D81G	probably benign	Het
Trpv5	T	A	6: 41,674,359	H251L	possibly damaging	Het
Ttc14	C	A	3: 33,800,388	T37K	possibly damaging	Het
Vmn2r80	A	T	10: 79,194,325	I662L	probably benign	Het
Vmn2r81	A	G	10: 79,293,815	I847V	probably benign	Het
Zfp474	A	G	18: 52,638,364	T30A	probably benign	Het
Zswim4	C	T	8: 84,230,951	V163M	probably damaging	Het

Other mutations in Sf3b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Sf3b3	APN	8	110813751	nonsense	probably null
IGL00770:Sf3b3	APN	8	110817638	missense	probably damaging	0.96
IGL00774:Sf3b3	APN	8	110817638	missense	probably damaging	0.96
IGL01132:Sf3b3	APN	8	110842781	missense	probably benign
IGL01487:Sf3b3	APN	8	110817660	missense	probably benign	0.01
IGL02015:Sf3b3	APN	8	110816290	missense	possibly damaging	0.82
IGL02126:Sf3b3	APN	8	110823443	missense	probably benign
IGL02612:Sf3b3	APN	8	110842976	missense	probably benign
IGL02833:Sf3b3	APN	8	110811977	critical splice donor site	probably null
IGL03033:Sf3b3	APN	8	110810964	missense	possibly damaging	0.62
IGL03366:Sf3b3	APN	8	110839954	missense	probably damaging	1.00
R0458:Sf3b3	UTSW	8	110812136	splice site	probably benign
R0907:Sf3b3	UTSW	8	110811510	splice site	probably benign
R1344:Sf3b3	UTSW	8	110838303	missense	probably damaging	0.98
R1468:Sf3b3	UTSW	8	110837374	missense	probably damaging	1.00
R1468:Sf3b3	UTSW	8	110837374	missense	probably damaging	1.00
R1736:Sf3b3	UTSW	8	110813832	missense	probably benign
R1833:Sf3b3	UTSW	8	110817566	missense	probably benign
R2225:Sf3b3	UTSW	8	110814573	missense	probably damaging	1.00
R3236:Sf3b3	UTSW	8	110812020	missense	probably damaging	0.99
R3615:Sf3b3	UTSW	8	110844523	missense	probably damaging	1.00
R3616:Sf3b3	UTSW	8	110844523	missense	probably damaging	1.00
R3683:Sf3b3	UTSW	8	110813621	critical splice donor site	probably null
R4197:Sf3b3	UTSW	8	110821565	missense	probably damaging	0.98
R4429:Sf3b3	UTSW	8	110826118	missense	probably benign	0.01
R4674:Sf3b3	UTSW	8	110844505	missense	probably damaging	0.99
R4895:Sf3b3	UTSW	8	110816024	missense	probably benign	0.00
R4931:Sf3b3	UTSW	8	110816329	missense	probably benign	0.00
R4948:Sf3b3	UTSW	8	110813669	missense	probably damaging	0.99
R4999:Sf3b3	UTSW	8	110841203	missense	probably benign	0.34
R5150:Sf3b3	UTSW	8	110823376	missense	possibly damaging	0.88
R5175:Sf3b3	UTSW	8	110833835	missense	probably benign
R5559:Sf3b3	UTSW	8	110838215	missense	probably benign	0.00
R5866:Sf3b3	UTSW	8	110814634	missense	probably benign
R5934:Sf3b3	UTSW	8	110823470	missense	probably damaging	0.99
R6803:Sf3b3	UTSW	8	110825578	missense	probably benign	0.01
R7078:Sf3b3	UTSW	8	110813007	missense	possibly damaging	0.90
R7252:Sf3b3	UTSW	8	110839930	missense	probably damaging	0.99
R7467:Sf3b3	UTSW	8	110811456	missense	possibly damaging	0.89
R7523:Sf3b3	UTSW	8	110813720	missense	probably benign	0.35
R7544:Sf3b3	UTSW	8	110838283	missense	probably benign	0.01
R7638:Sf3b3	UTSW	8	110820813	missense	probably damaging	1.00
R7934:Sf3b3	UTSW	8	110821530	missense	probably benign	0.05
R7973:Sf3b3	UTSW	8	110816290	missense	possibly damaging	0.82
R8141:Sf3b3	UTSW	8	110820851	missense	possibly damaging	0.87
R8745:Sf3b3	UTSW	8	110824184	missense	possibly damaging	0.94
R8914:Sf3b3	UTSW	8	110813807	missense	probably benign
R8948:Sf3b3	UTSW	8	110823443	missense	probably benign
R9269:Sf3b3	UTSW	8	110812026	missense	probably damaging	0.99
R9339:Sf3b3	UTSW	8	110816222	missense	probably benign
R9445:Sf3b3	UTSW	8	110826142	missense	possibly damaging	0.54
X0024:Sf3b3	UTSW	8	110842932	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AGTGCAGCAAAGACTCTCAG -3'
(R):5'- AGAGGGCAGTGTATTTGTACAG -3'

Sequencing Primer
(F):5'- GTGCAGCAAAGACTCTCAGTAAAGC -3'
(R):5'- TGAACGATAAGTAAAAACTGCCATAC -3'

Posted On

2018-03-15