Mutagenetix > Incidental Mutation

Incidental Mutation 'R6270:Fap'

507261

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62547788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 159 (I159V)

Ref Sequence

ENSEMBL: ENSMUSP00000000402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000173745] [ENSMUST00000174234] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably damaging
Transcript: ENSMUST00000000402
AA Change: I159V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: I159V

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102732
AA Change: I192V

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: I192V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172676

Predicted Effect

probably benign
Transcript: ENSMUST00000173745

SMART Domains

Protein: ENSMUSP00000134305
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
Pfam:DPPIV_N	12	63	2.9e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174234
AA Change: I167V

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: I167V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174448
AA Change: I187V

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: I187V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Meta Mutation Damage Score

0.1577

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8030462N17Rik	T	C	18: 77,674,421	D65G	probably damaging	Het
Acsl6	A	G	11: 54,352,107	E648G	probably benign	Het
Ak7	A	G	12: 105,768,701	H642R	probably benign	Het
Akap11	T	C	14: 78,518,799	E53G	probably damaging	Het
Ddr2	T	G	1: 169,988,540	T533P	probably benign	Het
Dhx40	A	G	11: 86,799,605	S197P	possibly damaging	Het
Dolpp1	C	A	2: 30,392,269		probably benign	Het
Eng	A	G	2: 32,673,643	D347G	probably benign	Het
Esrra	C	T	19: 6,914,120		probably null	Het
Fam208b	C	T	13: 3,581,891	R870H	possibly damaging	Het
Fn1	C	T	1: 71,637,275	C599Y	probably damaging	Het
Fnbp4	T	C	2: 90,757,463	V395A	probably damaging	Het
Foxn3	T	C	12: 99,388,417	R163G	probably damaging	Het
Gphn	T	G	12: 78,522,950	L306R	probably benign	Het
Gse1	T	C	8: 120,569,163		probably benign	Het
Habp2	A	G	19: 56,306,863	D62G	possibly damaging	Het
Hdac7	AGGG	AGGGG	15: 97,808,495		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Kit	A	G	5: 75,609,509	T194A	probably benign	Het
Krt16	C	A	11: 100,247,203	A316S	possibly damaging	Het
Krt7	A	G	15: 101,419,558	D244G	probably damaging	Het
Lhfpl3	T	A	5: 23,273,351	Y77*	probably null	Het
Lrrc18	A	T	14: 33,009,121	M206L	probably benign	Het
Magel2	C	A	7: 62,380,658	C1103*	probably null	Het
Mcf2l	T	C	8: 13,018,701	V1058A	probably damaging	Het
Nbas	G	A	12: 13,324,293	A541T	probably damaging	Het
Nrap	C	T	19: 56,320,198	M1485I	probably benign	Het
Nudt18	T	C	14: 70,579,390	Y145H	probably benign	Het
Olfr175-ps1	A	T	16: 58,824,419	C97S	probably damaging	Het
Olfr583	T	C	7: 103,051,331	L11P	probably benign	Het
Olfr623	T	C	7: 103,660,413	Y279C	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb12	A	T	18: 37,436,785	Q328L	possibly damaging	Het
Pde6c	T	C	19: 38,158,436	W431R	probably damaging	Het
Pga5	T	C	19: 10,674,861	E139G	probably benign	Het
Pkdrej	G	T	15: 85,821,105	S210*	probably null	Het
Pnpla1	G	A	17: 28,881,368	G403E	probably benign	Het
Sema3d	A	T	5: 12,448,107	M27L	probably benign	Het
Serinc5	T	C	13: 92,688,662	S200P	probably damaging	Het
Sf3b3	T	C	8: 110,841,820	D174G	probably damaging	Het
Sult1b1	A	T	5: 87,517,554		probably null	Het
Tcaf3	T	C	6: 42,593,791	I342M	probably benign	Het
Tenm3	G	A	8: 48,367,394	T136M	probably damaging	Het
Tet3	T	C	6: 83,375,791	T1008A	possibly damaging	Het
Tgif1	T	C	17: 70,844,866		probably null	Het
Trav15-2-dv6-2	A	G	14: 53,649,866	D81G	probably benign	Het
Trpv5	T	A	6: 41,674,359	H251L	possibly damaging	Het
Ttc14	C	A	3: 33,800,388	T37K	possibly damaging	Het
Vmn2r80	A	T	10: 79,194,325	I662L	probably benign	Het
Vmn2r81	A	G	10: 79,293,815	I847V	probably benign	Het
Zfp474	A	G	18: 52,638,364	T30A	probably benign	Het
Zswim4	C	T	8: 84,230,951	V163M	probably damaging	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R0842:Fap	UTSW	2	62537001	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3546:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3801:Fap	UTSW	2	62546650	missense	probably benign	0.04
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4323:Fap	UTSW	2	62503372	missense	probably damaging	0.97
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5281:Fap	UTSW	2	62532961	critical splice donor site	probably null
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8000:Fap	UTSW	2	62502798	critical splice donor site	probably null
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
R9521:Fap	UTSW	2	62542156	missense	probably benign
R9686:Fap	UTSW	2	62573513	missense	possibly damaging	0.86
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGACTAGCCTCCTTCTATCCATAAC -3'
(R):5'- TTTTGCATCTGAATTGCCAGCC -3'

Sequencing Primer
(F):5'- GGACAACCAGCTCATTAAA -3'
(R):5'- TGCCAGCCCTTTTAAAGACATAGG -3'

Posted On

2018-03-15