Incidental Mutation 'FR4548:Vps13b'
ID 512115
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # FR4548 ()
Quality Score 221.999
Status Not validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 35847103 bp (GRCm39)
Zygosity Homozygous
Amino Acid Change Alanine to Serine at position 2629 (A2629S)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: A2629S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: A2629S

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227567
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Het
1700001K19Rik CTT CTTTTT 12: 110,634,886 (GRCm39) probably benign Het
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
Abt1 TTCTTGCT TT 13: 23,607,881 (GRCm39) probably benign Het
Ahdc1 T TCCC 4: 132,790,071 (GRCm39) probably benign Homo
Ahdc1 TCC TCCCCC 4: 132,790,068 (GRCm39) probably benign Homo
AI837181 CGG CGGGGG 19: 5,475,259 (GRCm39) probably benign Het
AI837181 CG CGGGG 19: 5,475,265 (GRCm39) probably benign Het
Anxa2 CCC CCCTCC 9: 69,387,485 (GRCm39) probably benign Het
Anxa7 C T 14: 20,519,479 (GRCm39) G113E probably damaging Homo
Apc CCAATAAAG CCAATAAAGACAATAAAG 18: 34,415,051 (GRCm39) probably benign Het
Apol6 T TGTTA 15: 76,935,645 (GRCm39) probably null Homo
Blm CTAC CTACTTAC 7: 80,113,517 (GRCm39) probably null Homo
Brd2 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA 17: 34,335,310 (GRCm39) probably benign Het
Bud31 C T 5: 145,083,345 (GRCm39) R63C probably benign Het
C4b C T 17: 34,959,971 (GRCm39) R335H probably benign Het
Cacna1a ACC ACCCCC 8: 85,365,346 (GRCm39) probably benign Het
Cacna1f AGG AGGGGG X: 7,486,297 (GRCm39) probably benign Het
Ccdc170 ACC ACCCCC 10: 4,511,026 (GRCm39) probably benign Het
Cckbr GGGC G 7: 105,083,888 (GRCm39) probably benign Homo
Cd80 GAAA GAAAAAA 16: 38,306,681 (GRCm39) probably benign Homo
Ces1b T C 8: 93,794,720 (GRCm39) N293S probably null Homo
Cgnl1 CGC CGCGGC 9: 71,631,999 (GRCm39) probably benign Het
Cntnap1 AGCC AGCCCCCGCC 11: 101,080,419 (GRCm39) probably benign Het
Cntnap1 CCCAGC CCCAGCGCCAGC 11: 101,080,398 (GRCm39) probably benign Het
Cntnap1 CCAGCC CCAGCCTCAGCC 11: 101,080,405 (GRCm39) probably benign Het
Cntnap1 GCC GCCCCAACC 11: 101,080,420 (GRCm39) probably benign Het
Cracdl C A 1: 37,664,117 (GRCm39) E594* probably null Homo
Cracdl A G 1: 37,664,183 (GRCm39) S47P probably damaging Homo
Cracdl T A 1: 37,664,116 (GRCm39) E594V probably benign Homo
Ctsm GTGA GTGAATGA 13: 61,685,651 (GRCm39) probably null Homo
Cttnbp2 TGCTGC TGCTGCCGCTGC 6: 18,367,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,726 (GRCm39) probably null Het
Dusp10 G T 1: 183,769,253 (GRCm39) C73F probably damaging Homo
Efna4 ATGTGAT A 3: 89,241,729 (GRCm39) probably benign Homo
Eif3a A ATTTTT 19: 60,763,729 (GRCm39) probably benign Homo
Ermn TTC TTCATC 2: 57,938,087 (GRCm39) probably benign Het
Ermn TC TCTCC 2: 57,938,100 (GRCm39) probably benign Het
Fbxo43 GTGCCT GTGCCTATGCCT 15: 36,152,244 (GRCm39) probably null Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Fscb T A 12: 64,519,339 (GRCm39) Q709L unknown Het
Glod4 A C 11: 76,134,136 (GRCm39) probably benign Homo
Gm14401 A G 2: 176,778,661 (GRCm39) D249G probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,934 (GRCm39) probably benign Het
Gm4340 AGC AGCCGC 10: 104,031,931 (GRCm39) probably benign Het
Gm8104 T C 14: 42,967,468 (GRCm39) S179P probably damaging Het
Gm8104 C T 14: 42,967,466 (GRCm39) T178I probably benign Het
Gpatch11 GGAAGA GGAAGACGAAGA 17: 79,149,604 (GRCm39) probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-K2 GTTT G 17: 34,216,016 (GRCm39) probably benign Homo
Hspa1b GCGCC GC 17: 35,176,105 (GRCm39) probably benign Homo
Ifi211 G A 1: 173,733,759 (GRCm39) A134V possibly damaging Het
Igf1r C CTGGAGATGGAGG 7: 67,875,934 (GRCm39) probably benign Het
Igkv9-129 G A 6: 67,817,018 (GRCm39) V41I probably damaging Het
Ipo9 TCC TCCCCC 1: 135,314,013 (GRCm39) probably benign Het
Kcng4 G T 8: 120,360,258 (GRCm39) Y39* probably null Homo
Klra2 AG AGAAATCCACGG 6: 131,198,814 (GRCm39) probably null Het
Kmt2b CTCC CTCCTCGTCC 7: 30,285,805 (GRCm39) probably benign Het
Kng2 G A 16: 22,819,302 (GRCm39) Q245* probably null Het
Kri1 CTCCTCTTCCTC CTCCTC 9: 21,192,346 (GRCm39) probably benign Het
Krt10 TCCTCCAC TCCTCCACCTCCAC 11: 99,280,102 (GRCm39) probably benign Homo
Krt10 TCCTCC TCCTCCCCCTCC 11: 99,280,099 (GRCm39) probably benign Het
Las1l TC TCTTCCGC X: 94,984,231 (GRCm39) probably benign Het
Las1l GAG GAGAAG X: 94,984,429 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,462 (GRCm39) probably benign Het
Lrit3 GCT GCTACT 3: 129,582,465 (GRCm39) probably benign Het
Lrrc63 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 14: 75,362,622 (GRCm39) probably benign Homo
Luzp1 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA 4: 136,270,499 (GRCm39) probably benign Homo
Mast4 CA CAGTGGGA 13: 102,872,826 (GRCm39) probably benign Homo
Med12l AGC AGCGGC 3: 59,183,403 (GRCm39) probably benign Het
Mn1 GCA GCACCA 5: 111,567,564 (GRCm39) probably benign Het
Morn4 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG 19: 42,064,548 (GRCm39) probably benign Het
Msantd4 A T 9: 4,384,937 (GRCm39) I221F possibly damaging Homo
Mup21 TATACTT TATACTTTTTAAATACTT 4: 62,067,582 (GRCm39) probably benign Het
Mup21 ATACTT ATACTTTTTATCTACTT 4: 62,067,583 (GRCm39) probably benign Het
Nacad GG GGCCAGTG 11: 6,549,760 (GRCm39) probably benign Het
Nacad AGGGTC AGGGTCGGGGTC 11: 6,549,752 (GRCm39) probably benign Het
Ncapd2 CTT CTTGGTT 6: 125,150,559 (GRCm39) probably benign Homo
Nelfe GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC 17: 35,073,046 (GRCm39) probably benign Homo
Nfxl1 CCGGGG CCGGGGTCGGGG 5: 72,716,458 (GRCm39) probably benign Het
Nkx2-6 C T 14: 69,412,678 (GRCm39) T282M probably damaging Homo
Noc2l AGGC AGGCGGC 4: 156,324,549 (GRCm39) probably benign Homo
Noc2l GC GCTTC 4: 156,324,557 (GRCm39) probably benign Het
Nphp3 CACG C 9: 103,903,138 (GRCm39) probably benign Het
Nrg3 TTG TTGACACTG 14: 38,119,228 (GRCm39) probably benign Homo
Or2ak5 T G 11: 58,611,197 (GRCm39) I226L probably benign Het
Or51f1e T TTAG 7: 102,747,516 (GRCm39) probably null Homo
Or51v8 G GAAC 7: 103,320,174 (GRCm39) probably null Homo
Or51v8 CAAA CAAAAAA 7: 103,320,167 (GRCm39) probably benign Homo
Or5af2 T A 11: 58,708,266 (GRCm39) V144D possibly damaging Homo
Osmr CTC CTCTTC 15: 6,867,184 (GRCm39) probably benign Homo
Patl2 GCT GCTCCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l ACCAC ACCACCGCCAC 4: 134,006,823 (GRCm39) probably benign Homo
Phldb3 GACCC G 7: 24,328,403 (GRCm39) probably null Het
Piezo1 G A 8: 123,222,308 (GRCm39) R503W probably damaging Homo
Pik3ap1 AG AGGGG 19: 41,270,384 (GRCm39) probably benign Homo
Pkdrej TG TGGGAGCG 15: 85,703,881 (GRCm39) probably benign Homo
Polr1g GGATG GG 7: 19,091,169 (GRCm39) probably benign Homo
Ppp1r3f C A X: 7,426,575 (GRCm39) G562V probably damaging Homo
Prag1 GC GCAAC 8: 36,571,039 (GRCm39) probably benign Homo
Prr13 TCC TCCGCC 15: 102,370,609 (GRCm39) probably benign Het
Prtg GTAAC G 9: 72,764,363 (GRCm39) probably benign Homo
Ptk2b C T 14: 66,411,298 (GRCm39) R411Q possibly damaging Het
Ptms TTC TTCGTC 6: 124,891,419 (GRCm39) probably benign Het
Ptpn23 G T 9: 110,216,701 (GRCm39) P1052T probably benign Homo
Rbm33 AGCAGCCGCAGC AGCAGC 5: 28,599,199 (GRCm39) probably benign Het
Setd1a TGGTGGTGGT TGGTGGTGGTGGTGGTGGT 7: 127,384,479 (GRCm39) probably benign Homo
Setd1a TGGTAGTGG TGGTAGTGGCGGTAGTGG 7: 127,384,485 (GRCm39) probably benign Homo
Sfswap CCACTCAGC CCACTCAGCGCACTCAGC 5: 129,646,813 (GRCm39) probably benign Het
Sfswap AGCCCACTCGGCC AGCCCACTCGGCCCACTCGGCC 5: 129,646,819 (GRCm39) probably benign Homo
Sh3pxd2b GT GTGTCTCT 11: 32,373,064 (GRCm39) probably benign Homo
Sh3pxd2b T TGTCTTG 11: 32,373,065 (GRCm39) probably benign Het
Shroom4 GCAGCAACA GCA X: 6,536,128 (GRCm39) probably benign Het
Six3 GGC GGCCGC 17: 85,928,791 (GRCm39) probably benign Het
Slc12a1 ACC ACCTTTGGCCACAACCCC 2: 124,996,134 (GRCm39) probably benign Homo
Spaca1 GC GCTCTCTC 4: 34,049,856 (GRCm39) probably benign Het
Spag17 AGG AGGCGG 3: 99,963,570 (GRCm39) probably benign Het
Spata31h1 G GTCATTA 10: 82,126,830 (GRCm39) probably benign Homo
Srebf2 G T 15: 82,069,536 (GRCm39) A693S probably damaging Homo
Supt20 CA CAGCAGAA 3: 54,635,094 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,078 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGGAGCAG 3: 54,635,085 (GRCm39) probably benign Het
Syne1 C A 10: 4,982,969 (GRCm39) S8652I probably benign Homo
Tob1 GCA GCAACA 11: 94,105,281 (GRCm39) probably benign Het
Tob1 AGC AGCCGC 11: 94,105,295 (GRCm39) probably benign Het
Tomm5 CTTCCGC CTTCCGCATTTTCCGC 4: 45,107,977 (GRCm39) probably benign Het
Trav15-2-dv6-2 G GAAA 14: 53,887,214 (GRCm39) probably benign Het
Triobp TCG TCGCCG 15: 78,877,590 (GRCm39) probably benign Homo
Triobp TCG TCGGCG 15: 78,877,587 (GRCm39) probably benign Het
Tsbp1 GCA GCATCA 17: 34,679,039 (GRCm39) probably benign Het
Tsen2 GAG GAGAAG 6: 115,537,029 (GRCm39) probably benign Het
Ttf2 TC TCCGC 3: 100,870,476 (GRCm39) probably benign Homo
Tusc1 CGCCAC CGCCACTGCCAC 4: 93,223,540 (GRCm39) probably benign Het
Ubtf CTC CTCATC 11: 102,197,784 (GRCm39) probably benign Het
Utrn T TTCCTGTC 10: 12,509,685 (GRCm39) probably benign Homo
Vars1 TGG TGGAGTCCTGGGGGG 17: 35,234,965 (GRCm39) probably benign Homo
Vars1 G GAGTCCTGGGTGC 17: 35,234,967 (GRCm39) probably benign Het
Vmn2r99 G A 17: 19,614,547 (GRCm39) G756R probably damaging Het
Zc3h13 TGCG TGCGTGATGAGCG 14: 75,561,039 (GRCm39) probably benign Het
Zdhhc16 CACA CACAACAGGGAAAGCAGTCTGTCAACA 19: 41,930,607 (GRCm39) probably null Het
Zfp26 C A 9: 20,349,842 (GRCm39) A241S probably benign Homo
Zfp335 TCC TCCCCC 2: 164,749,392 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp598 ACCACC ACCACCCCCACC 17: 24,899,750 (GRCm39) probably benign Het
Zfp933 TT TTTGCCT 4: 147,910,188 (GRCm39) probably null Het
Zfp986 G T 4: 145,625,928 (GRCm39) R196I probably benign Het
Zfp992 G T 4: 146,550,464 (GRCm39) E62* probably null Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,675,105 (GRCm39) splice site probably benign
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1938:Vps13b UTSW 15 35,709,653 (GRCm39) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,450 (GRCm39) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,278 (GRCm39) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7092:Vps13b UTSW 15 35,640,780 (GRCm39) missense probably damaging 1.00
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTAAAACAATGGCCACTGGG -3'
(R):5'- ATGCTTACCAGGGAGCATG -3'

Sequencing Primer
(F):5'- CACTGGGCAGACAGCTG -3'
(R):5'- AGCATGGCCTGTGAGCATTC -3'
Posted On 2018-04-05